ID: 912497586

View in Genome Browser
Species Human (GRCh38)
Location 1:110101517-110101539
Sequence CCCTGCATCCTGCCTGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497586_912497591 -7 Left 912497586 1:110101517-110101539 CCGGAGCCAGGCAGGATGCAGGG No data
Right 912497591 1:110101533-110101555 TGCAGGGGGATTTCCGCACACGG No data
912497586_912497597 24 Left 912497586 1:110101517-110101539 CCGGAGCCAGGCAGGATGCAGGG No data
Right 912497597 1:110101564-110101586 CACCCTCGCTCTGCCCTGCCAGG No data
912497586_912497598 25 Left 912497586 1:110101517-110101539 CCGGAGCCAGGCAGGATGCAGGG No data
Right 912497598 1:110101565-110101587 ACCCTCGCTCTGCCCTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912497586 Original CRISPR CCCTGCATCCTGCCTGGCTC CGG (reversed) Intergenic