ID: 912497590

View in Genome Browser
Species Human (GRCh38)
Location 1:110101523-110101545
Sequence AAATCCCCCTGCATCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497590_912497598 19 Left 912497590 1:110101523-110101545 CCAGGCAGGATGCAGGGGGATTT No data
Right 912497598 1:110101565-110101587 ACCCTCGCTCTGCCCTGCCAGGG No data
912497590_912497597 18 Left 912497590 1:110101523-110101545 CCAGGCAGGATGCAGGGGGATTT No data
Right 912497597 1:110101564-110101586 CACCCTCGCTCTGCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912497590 Original CRISPR AAATCCCCCTGCATCCTGCC TGG (reversed) Intergenic