ID: 912497591

View in Genome Browser
Species Human (GRCh38)
Location 1:110101533-110101555
Sequence TGCAGGGGGATTTCCGCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497584_912497591 -6 Left 912497584 1:110101516-110101538 CCCGGAGCCAGGCAGGATGCAGG No data
Right 912497591 1:110101533-110101555 TGCAGGGGGATTTCCGCACACGG No data
912497577_912497591 30 Left 912497577 1:110101480-110101502 CCTAGACTGAGCTCAGTGCCAGT No data
Right 912497591 1:110101533-110101555 TGCAGGGGGATTTCCGCACACGG No data
912497582_912497591 -4 Left 912497582 1:110101514-110101536 CCCCCGGAGCCAGGCAGGATGCA No data
Right 912497591 1:110101533-110101555 TGCAGGGGGATTTCCGCACACGG No data
912497578_912497591 12 Left 912497578 1:110101498-110101520 CCAGTGTTCACTGCTGCCCCCGG No data
Right 912497591 1:110101533-110101555 TGCAGGGGGATTTCCGCACACGG No data
912497583_912497591 -5 Left 912497583 1:110101515-110101537 CCCCGGAGCCAGGCAGGATGCAG No data
Right 912497591 1:110101533-110101555 TGCAGGGGGATTTCCGCACACGG No data
912497586_912497591 -7 Left 912497586 1:110101517-110101539 CCGGAGCCAGGCAGGATGCAGGG No data
Right 912497591 1:110101533-110101555 TGCAGGGGGATTTCCGCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912497591 Original CRISPR TGCAGGGGGATTTCCGCACA CGG Intergenic