ID: 912497592

View in Genome Browser
Species Human (GRCh38)
Location 1:110101546-110101568
Sequence GGGTGAAAGGGGGCCGTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497592_912497597 -5 Left 912497592 1:110101546-110101568 CCGCACACGGCCCCCTTTCACCC No data
Right 912497597 1:110101564-110101586 CACCCTCGCTCTGCCCTGCCAGG No data
912497592_912497598 -4 Left 912497592 1:110101546-110101568 CCGCACACGGCCCCCTTTCACCC No data
Right 912497598 1:110101565-110101587 ACCCTCGCTCTGCCCTGCCAGGG No data
912497592_912497604 30 Left 912497592 1:110101546-110101568 CCGCACACGGCCCCCTTTCACCC No data
Right 912497604 1:110101599-110101621 TCCTCCCCAGTTTAGAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912497592 Original CRISPR GGGTGAAAGGGGGCCGTGTG CGG (reversed) Intergenic
No off target data available for this crispr