ID: 912497594

View in Genome Browser
Species Human (GRCh38)
Location 1:110101557-110101579
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497594_912497609 24 Left 912497594 1:110101557-110101579 CCCCTTTCACCCTCGCTCTGCCC No data
Right 912497609 1:110101604-110101626 CCCAGTTTAGAGTTCAGGATGGG No data
912497594_912497607 23 Left 912497594 1:110101557-110101579 CCCCTTTCACCCTCGCTCTGCCC No data
Right 912497607 1:110101603-110101625 CCCCAGTTTAGAGTTCAGGATGG No data
912497594_912497611 25 Left 912497594 1:110101557-110101579 CCCCTTTCACCCTCGCTCTGCCC No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497594_912497604 19 Left 912497594 1:110101557-110101579 CCCCTTTCACCCTCGCTCTGCCC No data
Right 912497604 1:110101599-110101621 TCCTCCCCAGTTTAGAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912497594 Original CRISPR GGGCAGAGCGAGGGTGAAAG GGG (reversed) Intergenic