ID: 912497595

View in Genome Browser
Species Human (GRCh38)
Location 1:110101558-110101580
Sequence AGGGCAGAGCGAGGGTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497595_912497607 22 Left 912497595 1:110101558-110101580 CCCTTTCACCCTCGCTCTGCCCT No data
Right 912497607 1:110101603-110101625 CCCCAGTTTAGAGTTCAGGATGG No data
912497595_912497609 23 Left 912497595 1:110101558-110101580 CCCTTTCACCCTCGCTCTGCCCT No data
Right 912497609 1:110101604-110101626 CCCAGTTTAGAGTTCAGGATGGG No data
912497595_912497611 24 Left 912497595 1:110101558-110101580 CCCTTTCACCCTCGCTCTGCCCT No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497595_912497604 18 Left 912497595 1:110101558-110101580 CCCTTTCACCCTCGCTCTGCCCT No data
Right 912497604 1:110101599-110101621 TCCTCCCCAGTTTAGAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912497595 Original CRISPR AGGGCAGAGCGAGGGTGAAA GGG (reversed) Intergenic
No off target data available for this crispr