ID: 912497597

View in Genome Browser
Species Human (GRCh38)
Location 1:110101564-110101586
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497586_912497597 24 Left 912497586 1:110101517-110101539 CCGGAGCCAGGCAGGATGCAGGG No data
Right 912497597 1:110101564-110101586 CACCCTCGCTCTGCCCTGCCAGG No data
912497590_912497597 18 Left 912497590 1:110101523-110101545 CCAGGCAGGATGCAGGGGGATTT No data
Right 912497597 1:110101564-110101586 CACCCTCGCTCTGCCCTGCCAGG No data
912497584_912497597 25 Left 912497584 1:110101516-110101538 CCCGGAGCCAGGCAGGATGCAGG No data
Right 912497597 1:110101564-110101586 CACCCTCGCTCTGCCCTGCCAGG No data
912497582_912497597 27 Left 912497582 1:110101514-110101536 CCCCCGGAGCCAGGCAGGATGCA No data
Right 912497597 1:110101564-110101586 CACCCTCGCTCTGCCCTGCCAGG No data
912497583_912497597 26 Left 912497583 1:110101515-110101537 CCCCGGAGCCAGGCAGGATGCAG No data
Right 912497597 1:110101564-110101586 CACCCTCGCTCTGCCCTGCCAGG No data
912497592_912497597 -5 Left 912497592 1:110101546-110101568 CCGCACACGGCCCCCTTTCACCC No data
Right 912497597 1:110101564-110101586 CACCCTCGCTCTGCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type