ID: 912497599

View in Genome Browser
Species Human (GRCh38)
Location 1:110101566-110101588
Sequence TCCCTGGCAGGGCAGAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497599_912497604 10 Left 912497599 1:110101566-110101588 CCCTCGCTCTGCCCTGCCAGGGA No data
Right 912497604 1:110101599-110101621 TCCTCCCCAGTTTAGAGTTCAGG No data
912497599_912497611 16 Left 912497599 1:110101566-110101588 CCCTCGCTCTGCCCTGCCAGGGA No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497599_912497607 14 Left 912497599 1:110101566-110101588 CCCTCGCTCTGCCCTGCCAGGGA No data
Right 912497607 1:110101603-110101625 CCCCAGTTTAGAGTTCAGGATGG No data
912497599_912497612 24 Left 912497599 1:110101566-110101588 CCCTCGCTCTGCCCTGCCAGGGA No data
Right 912497612 1:110101613-110101635 GAGTTCAGGATGGGGAGAGCTGG No data
912497599_912497609 15 Left 912497599 1:110101566-110101588 CCCTCGCTCTGCCCTGCCAGGGA No data
Right 912497609 1:110101604-110101626 CCCAGTTTAGAGTTCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912497599 Original CRISPR TCCCTGGCAGGGCAGAGCGA GGG (reversed) Intergenic