ID: 912497600

View in Genome Browser
Species Human (GRCh38)
Location 1:110101567-110101589
Sequence CTCCCTGGCAGGGCAGAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497600_912497604 9 Left 912497600 1:110101567-110101589 CCTCGCTCTGCCCTGCCAGGGAG No data
Right 912497604 1:110101599-110101621 TCCTCCCCAGTTTAGAGTTCAGG No data
912497600_912497611 15 Left 912497600 1:110101567-110101589 CCTCGCTCTGCCCTGCCAGGGAG No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497600_912497609 14 Left 912497600 1:110101567-110101589 CCTCGCTCTGCCCTGCCAGGGAG No data
Right 912497609 1:110101604-110101626 CCCAGTTTAGAGTTCAGGATGGG No data
912497600_912497607 13 Left 912497600 1:110101567-110101589 CCTCGCTCTGCCCTGCCAGGGAG No data
Right 912497607 1:110101603-110101625 CCCCAGTTTAGAGTTCAGGATGG No data
912497600_912497612 23 Left 912497600 1:110101567-110101589 CCTCGCTCTGCCCTGCCAGGGAG No data
Right 912497612 1:110101613-110101635 GAGTTCAGGATGGGGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912497600 Original CRISPR CTCCCTGGCAGGGCAGAGCG AGG (reversed) Intergenic
No off target data available for this crispr