ID: 912497602

View in Genome Browser
Species Human (GRCh38)
Location 1:110101578-110101600
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497602_912497609 3 Left 912497602 1:110101578-110101600 CCTGCCAGGGAGATGCTCGTATC No data
Right 912497609 1:110101604-110101626 CCCAGTTTAGAGTTCAGGATGGG No data
912497602_912497611 4 Left 912497602 1:110101578-110101600 CCTGCCAGGGAGATGCTCGTATC No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497602_912497604 -2 Left 912497602 1:110101578-110101600 CCTGCCAGGGAGATGCTCGTATC No data
Right 912497604 1:110101599-110101621 TCCTCCCCAGTTTAGAGTTCAGG No data
912497602_912497612 12 Left 912497602 1:110101578-110101600 CCTGCCAGGGAGATGCTCGTATC No data
Right 912497612 1:110101613-110101635 GAGTTCAGGATGGGGAGAGCTGG No data
912497602_912497607 2 Left 912497602 1:110101578-110101600 CCTGCCAGGGAGATGCTCGTATC No data
Right 912497607 1:110101603-110101625 CCCCAGTTTAGAGTTCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912497602 Original CRISPR GATACGAGCATCTCCCTGGC AGG (reversed) Intergenic