ID: 912497611

View in Genome Browser
Species Human (GRCh38)
Location 1:110101605-110101627
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497594_912497611 25 Left 912497594 1:110101557-110101579 CCCCTTTCACCCTCGCTCTGCCC No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497593_912497611 26 Left 912497593 1:110101556-110101578 CCCCCTTTCACCCTCGCTCTGCC No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497601_912497611 5 Left 912497601 1:110101577-110101599 CCCTGCCAGGGAGATGCTCGTAT No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497603_912497611 0 Left 912497603 1:110101582-110101604 CCAGGGAGATGCTCGTATCCTCC No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497600_912497611 15 Left 912497600 1:110101567-110101589 CCTCGCTCTGCCCTGCCAGGGAG No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497602_912497611 4 Left 912497602 1:110101578-110101600 CCTGCCAGGGAGATGCTCGTATC No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497595_912497611 24 Left 912497595 1:110101558-110101580 CCCTTTCACCCTCGCTCTGCCCT No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497596_912497611 23 Left 912497596 1:110101559-110101581 CCTTTCACCCTCGCTCTGCCCTG No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data
912497599_912497611 16 Left 912497599 1:110101566-110101588 CCCTCGCTCTGCCCTGCCAGGGA No data
Right 912497611 1:110101605-110101627 CCAGTTTAGAGTTCAGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr