ID: 912497612

View in Genome Browser
Species Human (GRCh38)
Location 1:110101613-110101635
Sequence GAGTTCAGGATGGGGAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912497599_912497612 24 Left 912497599 1:110101566-110101588 CCCTCGCTCTGCCCTGCCAGGGA No data
Right 912497612 1:110101613-110101635 GAGTTCAGGATGGGGAGAGCTGG No data
912497601_912497612 13 Left 912497601 1:110101577-110101599 CCCTGCCAGGGAGATGCTCGTAT No data
Right 912497612 1:110101613-110101635 GAGTTCAGGATGGGGAGAGCTGG No data
912497603_912497612 8 Left 912497603 1:110101582-110101604 CCAGGGAGATGCTCGTATCCTCC No data
Right 912497612 1:110101613-110101635 GAGTTCAGGATGGGGAGAGCTGG No data
912497600_912497612 23 Left 912497600 1:110101567-110101589 CCTCGCTCTGCCCTGCCAGGGAG No data
Right 912497612 1:110101613-110101635 GAGTTCAGGATGGGGAGAGCTGG No data
912497602_912497612 12 Left 912497602 1:110101578-110101600 CCTGCCAGGGAGATGCTCGTATC No data
Right 912497612 1:110101613-110101635 GAGTTCAGGATGGGGAGAGCTGG No data
912497605_912497612 -10 Left 912497605 1:110101600-110101622 CCTCCCCAGTTTAGAGTTCAGGA No data
Right 912497612 1:110101613-110101635 GAGTTCAGGATGGGGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912497612 Original CRISPR GAGTTCAGGATGGGGAGAGC TGG Intergenic
No off target data available for this crispr