ID: 912501649

View in Genome Browser
Species Human (GRCh38)
Location 1:110126626-110126648
Sequence CCCTGTGGAAGCCCCTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912501646_912501649 -9 Left 912501646 1:110126612-110126634 CCTGGTGGAGGAACCCCTGTGGA No data
Right 912501649 1:110126626-110126648 CCCTGTGGAAGCCCCTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912501649 Original CRISPR CCCTGTGGAAGCCCCTGCAG TGG Intergenic
No off target data available for this crispr