ID: 912502844

View in Genome Browser
Species Human (GRCh38)
Location 1:110133681-110133703
Sequence AAAGGATGACTCCTGGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912502844_912502856 30 Left 912502844 1:110133681-110133703 CCCCTTGCCAGGAGTCATCCTTT No data
Right 912502856 1:110133734-110133756 AGCTTCCTGGGCCCAGGCTGAGG No data
912502844_912502855 24 Left 912502844 1:110133681-110133703 CCCCTTGCCAGGAGTCATCCTTT No data
Right 912502855 1:110133728-110133750 GTTGGAAGCTTCCTGGGCCCAGG No data
912502844_912502853 18 Left 912502844 1:110133681-110133703 CCCCTTGCCAGGAGTCATCCTTT No data
Right 912502853 1:110133722-110133744 TCCATGGTTGGAAGCTTCCTGGG No data
912502844_912502850 6 Left 912502844 1:110133681-110133703 CCCCTTGCCAGGAGTCATCCTTT No data
Right 912502850 1:110133710-110133732 AAAGCAAATTCCTCCATGGTTGG No data
912502844_912502852 17 Left 912502844 1:110133681-110133703 CCCCTTGCCAGGAGTCATCCTTT No data
Right 912502852 1:110133721-110133743 CTCCATGGTTGGAAGCTTCCTGG No data
912502844_912502849 2 Left 912502844 1:110133681-110133703 CCCCTTGCCAGGAGTCATCCTTT No data
Right 912502849 1:110133706-110133728 CTTCAAAGCAAATTCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912502844 Original CRISPR AAAGGATGACTCCTGGCAAG GGG (reversed) Intergenic
No off target data available for this crispr