ID: 912502845

View in Genome Browser
Species Human (GRCh38)
Location 1:110133682-110133704
Sequence CAAAGGATGACTCCTGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912502845_912502849 1 Left 912502845 1:110133682-110133704 CCCTTGCCAGGAGTCATCCTTTG No data
Right 912502849 1:110133706-110133728 CTTCAAAGCAAATTCCTCCATGG No data
912502845_912502852 16 Left 912502845 1:110133682-110133704 CCCTTGCCAGGAGTCATCCTTTG No data
Right 912502852 1:110133721-110133743 CTCCATGGTTGGAAGCTTCCTGG No data
912502845_912502850 5 Left 912502845 1:110133682-110133704 CCCTTGCCAGGAGTCATCCTTTG No data
Right 912502850 1:110133710-110133732 AAAGCAAATTCCTCCATGGTTGG No data
912502845_912502855 23 Left 912502845 1:110133682-110133704 CCCTTGCCAGGAGTCATCCTTTG No data
Right 912502855 1:110133728-110133750 GTTGGAAGCTTCCTGGGCCCAGG No data
912502845_912502853 17 Left 912502845 1:110133682-110133704 CCCTTGCCAGGAGTCATCCTTTG No data
Right 912502853 1:110133722-110133744 TCCATGGTTGGAAGCTTCCTGGG No data
912502845_912502856 29 Left 912502845 1:110133682-110133704 CCCTTGCCAGGAGTCATCCTTTG No data
Right 912502856 1:110133734-110133756 AGCTTCCTGGGCCCAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912502845 Original CRISPR CAAAGGATGACTCCTGGCAA GGG (reversed) Intergenic
No off target data available for this crispr