ID: 912502848

View in Genome Browser
Species Human (GRCh38)
Location 1:110133699-110133721
Sequence GGAATTTGCTTTGAAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912502848_912502856 12 Left 912502848 1:110133699-110133721 CCTTTGTCTTCAAAGCAAATTCC No data
Right 912502856 1:110133734-110133756 AGCTTCCTGGGCCCAGGCTGAGG No data
912502848_912502853 0 Left 912502848 1:110133699-110133721 CCTTTGTCTTCAAAGCAAATTCC No data
Right 912502853 1:110133722-110133744 TCCATGGTTGGAAGCTTCCTGGG No data
912502848_912502855 6 Left 912502848 1:110133699-110133721 CCTTTGTCTTCAAAGCAAATTCC No data
Right 912502855 1:110133728-110133750 GTTGGAAGCTTCCTGGGCCCAGG No data
912502848_912502852 -1 Left 912502848 1:110133699-110133721 CCTTTGTCTTCAAAGCAAATTCC No data
Right 912502852 1:110133721-110133743 CTCCATGGTTGGAAGCTTCCTGG No data
912502848_912502858 19 Left 912502848 1:110133699-110133721 CCTTTGTCTTCAAAGCAAATTCC No data
Right 912502858 1:110133741-110133763 TGGGCCCAGGCTGAGGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912502848 Original CRISPR GGAATTTGCTTTGAAGACAA AGG (reversed) Intergenic
No off target data available for this crispr