ID: 912502849

View in Genome Browser
Species Human (GRCh38)
Location 1:110133706-110133728
Sequence CTTCAAAGCAAATTCCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912502845_912502849 1 Left 912502845 1:110133682-110133704 CCCTTGCCAGGAGTCATCCTTTG No data
Right 912502849 1:110133706-110133728 CTTCAAAGCAAATTCCTCCATGG No data
912502844_912502849 2 Left 912502844 1:110133681-110133703 CCCCTTGCCAGGAGTCATCCTTT No data
Right 912502849 1:110133706-110133728 CTTCAAAGCAAATTCCTCCATGG No data
912502847_912502849 -5 Left 912502847 1:110133688-110133710 CCAGGAGTCATCCTTTGTCTTCA No data
Right 912502849 1:110133706-110133728 CTTCAAAGCAAATTCCTCCATGG No data
912502846_912502849 0 Left 912502846 1:110133683-110133705 CCTTGCCAGGAGTCATCCTTTGT No data
Right 912502849 1:110133706-110133728 CTTCAAAGCAAATTCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912502849 Original CRISPR CTTCAAAGCAAATTCCTCCA TGG Intergenic
No off target data available for this crispr