ID: 912502850

View in Genome Browser
Species Human (GRCh38)
Location 1:110133710-110133732
Sequence AAAGCAAATTCCTCCATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912502846_912502850 4 Left 912502846 1:110133683-110133705 CCTTGCCAGGAGTCATCCTTTGT No data
Right 912502850 1:110133710-110133732 AAAGCAAATTCCTCCATGGTTGG No data
912502847_912502850 -1 Left 912502847 1:110133688-110133710 CCAGGAGTCATCCTTTGTCTTCA No data
Right 912502850 1:110133710-110133732 AAAGCAAATTCCTCCATGGTTGG No data
912502845_912502850 5 Left 912502845 1:110133682-110133704 CCCTTGCCAGGAGTCATCCTTTG No data
Right 912502850 1:110133710-110133732 AAAGCAAATTCCTCCATGGTTGG No data
912502844_912502850 6 Left 912502844 1:110133681-110133703 CCCCTTGCCAGGAGTCATCCTTT No data
Right 912502850 1:110133710-110133732 AAAGCAAATTCCTCCATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912502850 Original CRISPR AAAGCAAATTCCTCCATGGT TGG Intergenic
No off target data available for this crispr