ID: 912502851

View in Genome Browser
Species Human (GRCh38)
Location 1:110133720-110133742
Sequence CAGGAAGCTTCCAACCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912502851_912502863 16 Left 912502851 1:110133720-110133742 CCTCCATGGTTGGAAGCTTCCTG No data
Right 912502863 1:110133759-110133781 TATGGCCAACTTCCTGGCCAAGG No data
912502851_912502858 -2 Left 912502851 1:110133720-110133742 CCTCCATGGTTGGAAGCTTCCTG No data
Right 912502858 1:110133741-110133763 TGGGCCCAGGCTGAGGCCTATGG No data
912502851_912502861 10 Left 912502851 1:110133720-110133742 CCTCCATGGTTGGAAGCTTCCTG No data
Right 912502861 1:110133753-110133775 GAGGCCTATGGCCAACTTCCTGG No data
912502851_912502856 -9 Left 912502851 1:110133720-110133742 CCTCCATGGTTGGAAGCTTCCTG No data
Right 912502856 1:110133734-110133756 AGCTTCCTGGGCCCAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912502851 Original CRISPR CAGGAAGCTTCCAACCATGG AGG (reversed) Intergenic
No off target data available for this crispr