ID: 912502856

View in Genome Browser
Species Human (GRCh38)
Location 1:110133734-110133756
Sequence AGCTTCCTGGGCCCAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912502847_912502856 23 Left 912502847 1:110133688-110133710 CCAGGAGTCATCCTTTGTCTTCA No data
Right 912502856 1:110133734-110133756 AGCTTCCTGGGCCCAGGCTGAGG No data
912502846_912502856 28 Left 912502846 1:110133683-110133705 CCTTGCCAGGAGTCATCCTTTGT No data
Right 912502856 1:110133734-110133756 AGCTTCCTGGGCCCAGGCTGAGG No data
912502845_912502856 29 Left 912502845 1:110133682-110133704 CCCTTGCCAGGAGTCATCCTTTG No data
Right 912502856 1:110133734-110133756 AGCTTCCTGGGCCCAGGCTGAGG No data
912502851_912502856 -9 Left 912502851 1:110133720-110133742 CCTCCATGGTTGGAAGCTTCCTG No data
Right 912502856 1:110133734-110133756 AGCTTCCTGGGCCCAGGCTGAGG No data
912502844_912502856 30 Left 912502844 1:110133681-110133703 CCCCTTGCCAGGAGTCATCCTTT No data
Right 912502856 1:110133734-110133756 AGCTTCCTGGGCCCAGGCTGAGG No data
912502848_912502856 12 Left 912502848 1:110133699-110133721 CCTTTGTCTTCAAAGCAAATTCC No data
Right 912502856 1:110133734-110133756 AGCTTCCTGGGCCCAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912502856 Original CRISPR AGCTTCCTGGGCCCAGGCTG AGG Intergenic
No off target data available for this crispr