ID: 912502858

View in Genome Browser
Species Human (GRCh38)
Location 1:110133741-110133763
Sequence TGGGCCCAGGCTGAGGCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912502854_912502858 -5 Left 912502854 1:110133723-110133745 CCATGGTTGGAAGCTTCCTGGGC No data
Right 912502858 1:110133741-110133763 TGGGCCCAGGCTGAGGCCTATGG No data
912502851_912502858 -2 Left 912502851 1:110133720-110133742 CCTCCATGGTTGGAAGCTTCCTG No data
Right 912502858 1:110133741-110133763 TGGGCCCAGGCTGAGGCCTATGG No data
912502847_912502858 30 Left 912502847 1:110133688-110133710 CCAGGAGTCATCCTTTGTCTTCA No data
Right 912502858 1:110133741-110133763 TGGGCCCAGGCTGAGGCCTATGG No data
912502848_912502858 19 Left 912502848 1:110133699-110133721 CCTTTGTCTTCAAAGCAAATTCC No data
Right 912502858 1:110133741-110133763 TGGGCCCAGGCTGAGGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912502858 Original CRISPR TGGGCCCAGGCTGAGGCCTA TGG Intergenic
No off target data available for this crispr