ID: 912503933

View in Genome Browser
Species Human (GRCh38)
Location 1:110142542-110142564
Sequence TGTCCCCGATCTCACAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912503933_912503936 28 Left 912503933 1:110142542-110142564 CCAGGTCTGTGAGATCGGGGACA No data
Right 912503936 1:110142593-110142615 TGTTCTCTGTTTCTTTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912503933 Original CRISPR TGTCCCCGATCTCACAGACC TGG (reversed) Intergenic
No off target data available for this crispr