ID: 912504386

View in Genome Browser
Species Human (GRCh38)
Location 1:110146087-110146109
Sequence AGTCATAACCATAAAGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912504386_912504390 9 Left 912504386 1:110146087-110146109 CCAAACCCTTTATGGTTATGACT No data
Right 912504390 1:110146119-110146141 GTGTCTCCTGCCCTCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912504386 Original CRISPR AGTCATAACCATAAAGGGTT TGG (reversed) Intergenic
No off target data available for this crispr