ID: 912504663

View in Genome Browser
Species Human (GRCh38)
Location 1:110148065-110148087
Sequence CATGGCCACCAACTTCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912504663_912504668 2 Left 912504663 1:110148065-110148087 CCCACTTGAAGTTGGTGGCCATG 0: 1
1: 0
2: 2
3: 28
4: 191
Right 912504668 1:110148090-110148112 GGCAGACAGAGACTGGTCTGTGG 0: 1
1: 0
2: 0
3: 41
4: 348
912504663_912504667 -5 Left 912504663 1:110148065-110148087 CCCACTTGAAGTTGGTGGCCATG 0: 1
1: 0
2: 2
3: 28
4: 191
Right 912504667 1:110148083-110148105 CCATGAAGGCAGACAGAGACTGG 0: 1
1: 0
2: 2
3: 32
4: 388
912504663_912504669 26 Left 912504663 1:110148065-110148087 CCCACTTGAAGTTGGTGGCCATG 0: 1
1: 0
2: 2
3: 28
4: 191
Right 912504669 1:110148114-110148136 GTGTTTCTGTCTAGAGAACTTGG 0: 1
1: 0
2: 2
3: 11
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912504663 Original CRISPR CATGGCCACCAACTTCAAGT GGG (reversed) Intergenic
900180414 1:1308703-1308725 CGTGGGCACCGACTTTAAGTAGG + Exonic
904163482 1:28537851-28537873 CATGGGCACCAACTACCAGCTGG + Exonic
906092716 1:43196138-43196160 CATGACCACAAACCTCCAGTGGG - Intronic
906158300 1:43627375-43627397 CAACGCCACCAAATTCCAGTTGG - Intergenic
906221876 1:44086950-44086972 CATGACCACTTACCTCAAGTGGG - Intergenic
906661955 1:47589329-47589351 CATGGTTACCAACTTCAGCTAGG + Intergenic
907070752 1:51532573-51532595 CATCGCCACTGACCTCAAGTGGG - Intergenic
908670984 1:66547526-66547548 CATGGCAACCCAGTTCAAGTTGG + Intronic
908727353 1:67191100-67191122 CATGACCACTAACCTCAACTGGG + Intronic
909305009 1:74062824-74062846 CACACCCACCACCTTCAAGTAGG - Intronic
910071425 1:83218866-83218888 CATGACCACAGACCTCAAGTAGG + Intergenic
911549552 1:99263154-99263176 CATGACCACAAACTCCAAGTAGG - Intergenic
912504663 1:110148065-110148087 CATGGCCACCAACTTCAAGTGGG - Intergenic
912932155 1:113973502-113973524 CATGCTCACCAACTATAAGTAGG - Exonic
913058848 1:115186458-115186480 CATTGACCCCCACTTCAAGTAGG - Intergenic
913418855 1:118641531-118641553 CTTGGCCACCATGATCAAGTGGG + Intergenic
914416535 1:147488517-147488539 AATGACCACAAACCTCAAGTGGG - Intergenic
915534805 1:156528911-156528933 CCTGGCCCCCGACTCCAAGTAGG - Exonic
916664939 1:166958049-166958071 CATGGCCACCTTCTTCTTGTCGG + Exonic
917819463 1:178747733-178747755 CATGCCCACCACCATCAAGTGGG - Intronic
918882529 1:190143779-190143801 CCTGGCCACCACCTTGAATTTGG - Intronic
919821645 1:201476718-201476740 CATTGCGACAGACTTCAAGTGGG + Intergenic
921677027 1:217987656-217987678 CATGGCCACCAAAGTTAAGCAGG + Intergenic
924070791 1:240276174-240276196 CATGGCCACTAACCTCAGGTGGG - Intronic
1063699985 10:8374989-8375011 CCTGGCCTCCACCCTCAAGTAGG + Intergenic
1064346483 10:14537268-14537290 CATGGACACCAGCTCCAAGATGG - Intronic
1064768424 10:18698489-18698511 CATGGGCACAGACTGCAAGTAGG - Intergenic
1067330502 10:45311675-45311697 CCTACCCTCCAACTTCAAGTAGG - Intronic
1069277720 10:66613211-66613233 CATGGCCATCAAACTCAAGTGGG - Intronic
1069349783 10:67511544-67511566 CTTGGCCACCACAATCAAGTAGG - Intronic
1070065726 10:73032069-73032091 CATGAATACCAACTTCAAATGGG + Intronic
1071613649 10:87055109-87055131 CCTGACCACTAACCTCAAGTAGG - Intronic
1072000953 10:91195191-91195213 CATAACCACAAACTTTAAGTGGG - Intronic
1077977615 11:7264295-7264317 CATGATCGCCAACTTCAAGCAGG - Intronic
1081047874 11:38298144-38298166 CATTGCCACCAATTTGATGTGGG - Intergenic
1081572471 11:44300365-44300387 CATGGCCTCTGACTTCAAGGAGG - Intronic
1084511274 11:69605809-69605831 CATGGACACCAAATTCTAGAGGG - Intergenic
1084627110 11:70316580-70316602 CATGGTCCCCAACCTCACGTGGG - Intronic
1087573338 11:99959213-99959235 CATGATCATCAATTTCAAGTGGG + Intronic
1091081014 11:132667843-132667865 CTTGACCACCAACTACAAATGGG - Intronic
1091671406 12:2454671-2454693 CATGACCTCCAACCTCAAGGAGG + Intronic
1092168628 12:6359351-6359373 CACGGCCTCCAGCATCAAGTTGG - Intronic
1092837587 12:12505515-12505537 CATGACCACCATTTACAAGTTGG + Intronic
1093177897 12:15934002-15934024 GAAGGCCTCCAACATCAAGTTGG + Intronic
1093202569 12:16207598-16207620 CATGATCACCAACATCAACTGGG + Intronic
1094398339 12:30033078-30033100 CATGACCACAGACTTCATGTGGG - Intergenic
1095426069 12:42075864-42075886 CATGGCCATGAATTTAAAGTAGG + Intergenic
1098646137 12:72903673-72903695 CTTGGCCACCAACATCAGGCAGG + Intergenic
1100396310 12:94189057-94189079 CAGGACCATCAACCTCAAGTGGG - Intronic
1101222080 12:102652039-102652061 CATGGCTACCAAGTTCACATCGG - Intergenic
1101524528 12:105516201-105516223 CATGTCCACCATGATCAAGTGGG - Intergenic
1102428597 12:112863731-112863753 CATTGCCACCCACTTCCAGGAGG - Intronic
1105791454 13:23803729-23803751 CAAGTCCACCAACTTGATGTCGG + Intronic
1107097568 13:36552881-36552903 CATGGCCTCTAACCTCAAGTAGG - Intergenic
1107204321 13:37763541-37763563 CATGACCACTAATTTCAAGTGGG - Intronic
1107420228 13:40239393-40239415 CATGGCCACCATAATCATGTGGG - Intergenic
1107888568 13:44894492-44894514 CCTGGCCACAAACTCCATGTGGG + Intergenic
1108934815 13:55870943-55870965 CATTCCCACCACCTTCAGGTTGG + Intergenic
1110373901 13:74770205-74770227 CATAGCCAGCAATTTCTAGTGGG + Intergenic
1110410583 13:75200211-75200233 TATGGTCACCAACCTCAATTTGG - Intergenic
1110442267 13:75538782-75538804 CATGATCACCAAATTCAAGGCGG - Intronic
1111919515 13:94395926-94395948 CTTGCCCACCAGCTTCCAGTTGG + Intronic
1111972689 13:94933587-94933609 CATGGCCACCGATATGAAGTGGG + Intergenic
1112841590 13:103585747-103585769 CAAGGCCACCAACTGGAAGTGGG + Intergenic
1115759834 14:36568893-36568915 TATGACCACCAACTTCAAATGGG - Intergenic
1121647207 14:95526634-95526656 CTAGGCCATCAACTTCTAGTTGG - Intergenic
1125478149 15:40061662-40061684 TCTGACCACAAACTTCAAGTGGG - Intergenic
1125779167 15:42248632-42248654 CATGTCCACCAAGATCAAGTTGG - Intronic
1128463590 15:67890035-67890057 TATGACCACAAACCTCAAGTGGG - Intergenic
1129399722 15:75274953-75274975 CCTGGACACCAGCCTCAAGTAGG - Intronic
1129473182 15:75766358-75766380 CCTGGACACCAGCCTCAAGTAGG + Intergenic
1129731427 15:77934764-77934786 CCTGGACACCAGCCTCAAGTAGG + Intergenic
1132936838 16:2485584-2485606 CTCAGCAACCAACTTCAAGTTGG - Intronic
1134037507 16:11042120-11042142 CATGGCTCCCAACATCCAGTGGG - Intronic
1140127091 16:72126458-72126480 CATGTCCACTAACCTCAAATCGG - Intronic
1140464959 16:75174129-75174151 CATGACCACTAACCTCAAGTGGG - Intergenic
1141138561 16:81482558-81482580 CATGTCCACCAGGCTCAAGTGGG - Intronic
1141874171 16:86810124-86810146 CCTGGTCATCATCTTCAAGTCGG + Intergenic
1146097168 17:29942015-29942037 CATGGCGACCTGCTTCTAGTTGG + Intronic
1147613419 17:41814203-41814225 CATGGCCACTAATTTCCTGTGGG - Intronic
1150133191 17:62680243-62680265 CATGGCCACCCACTGCAGGGAGG - Exonic
1150821406 17:68437205-68437227 GTTGGCCAGTAACTTCAAGTTGG + Intronic
1153262705 18:3239839-3239861 AATGACCACAGACTTCAAGTGGG - Intergenic
1158079714 18:53575584-53575606 TATGGCCACTTACTTCATGTTGG + Intergenic
1158515425 18:58126713-58126735 CATTCCCACCAGCATCAAGTGGG + Intronic
1158703303 18:59768903-59768925 CATGGCTCCCAGTTTCAAGTGGG + Intergenic
1159318437 18:66812526-66812548 CATGGCTACCAACTGTGAGTAGG + Intergenic
1162544730 19:11321904-11321926 CATGGCCACCACCTTGACCTTGG - Intronic
1163580235 19:18134648-18134670 CATGGCCACCAACCTCTATGAGG + Exonic
1166364280 19:42270604-42270626 TATGCCCTCCAACTCCAAGTGGG - Intronic
925485066 2:4319572-4319594 AATGACCTCTAACTTCAAGTTGG + Intergenic
927800298 2:26092776-26092798 CATGACCAACAACTTCAGCTAGG - Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930431962 2:51289409-51289431 CATGGCCAGAAAATGCAAGTGGG - Intergenic
932693106 2:73930311-73930333 CATGACCACTAACTCCAAGTGGG - Intronic
933813927 2:86050861-86050883 CAAGGTCACCCACTTCCAGTTGG - Intronic
934012600 2:87839763-87839785 CATACCCTCCACCTTCAAGTAGG - Intergenic
935265624 2:101391470-101391492 TATGGCCATTAACTTCAAGGGGG + Intergenic
936549020 2:113418689-113418711 CTTGTCCACCAGCTTCAACTGGG - Intergenic
939112764 2:138028178-138028200 CATGACCACTAATCTCAAGTGGG + Intergenic
940458250 2:153929497-153929519 CATACCCTCCACCTTCAAGTAGG + Intronic
946368330 2:219264875-219264897 CATGGCCACTAGCCTCAAATGGG - Intronic
1169062146 20:2668596-2668618 CATGGTCACCAACCTCAACAGGG - Intergenic
1169542809 20:6618981-6619003 CTGGCCCACCAGCTTCAAGTTGG + Intergenic
1169638934 20:7726523-7726545 TATTGCCACTAACTTCAAATGGG - Intergenic
1170175046 20:13459567-13459589 CATGGTCACTATCTTCAATTTGG + Intronic
1175556498 20:59862802-59862824 TATGGCCACGTACTTCAAATGGG - Intergenic
1179157630 21:38863736-38863758 CAAGGCCACCATCTTCCAGGTGG - Intergenic
1179373630 21:40829400-40829422 CATGACCACAAACCTCGAGTGGG - Intronic
1181467013 22:23115709-23115731 CCCGGCCCCCAACTTCAGGTGGG - Intronic
1181877987 22:25955133-25955155 CCTGGCCTCCAACTCCAAGGTGG + Intronic
949725212 3:7036233-7036255 CATGGCCAATAATTTGAAGTAGG + Intronic
951457115 3:22905007-22905029 CATGGCTACAAACTTCAGGCTGG - Intergenic
951519509 3:23598233-23598255 CAAGGCCACCATCGTGAAGTTGG - Intergenic
952006124 3:28844733-28844755 CATAGCGACAAACTTCAGGTTGG + Intergenic
953107803 3:39902375-39902397 AGTGACCACAAACTTCAAGTTGG - Intronic
954070425 3:48138985-48139007 CTTGGCCACCAACTTGAGGAGGG + Intergenic
955097339 3:55812558-55812580 CAGGGCACCCAACTACAAGTGGG + Intronic
956016632 3:64890589-64890611 GATAGCCACCAGCTTCATGTAGG - Intergenic
959000809 3:100962067-100962089 CATGGTCACTAATCTCAAGTGGG + Intronic
960348683 3:116567021-116567043 CAGGGCCATCAACTTCTACTAGG - Intronic
961150672 3:124635094-124635116 CAGGGCCACCAACATCACCTAGG - Intronic
961795963 3:129408976-129408998 GATGGCAACCAACGTCCAGTGGG + Intronic
962336323 3:134534736-134534758 CATGGTCACTAACCTCAAATGGG + Intronic
962502544 3:136009957-136009979 CATGACCACCAACCTCCAGTGGG + Intronic
962818617 3:139024752-139024774 CATGATCACCAACCTCCAGTGGG + Intronic
962924967 3:139984409-139984431 CATGGCCACCAAAACCAAATAGG - Intronic
964381810 3:156105087-156105109 CATGGCCTCCAACTTCAGGCAGG + Intronic
965797919 3:172460455-172460477 CATGATCATTAACTTCAAGTGGG - Intergenic
966318285 3:178673282-178673304 CATGTCCATAAACCTCAAGTGGG + Intronic
967295510 3:187960485-187960507 AATGGGCACCAGCATCAAGTTGG - Intergenic
969854629 4:9989307-9989329 CATGACCACCAACCTCAAGAAGG + Intronic
972046134 4:34666730-34666752 CATGGCCTCCATAATCAAGTGGG - Intergenic
972998491 4:44914146-44914168 ACTGGCCACCACATTCAAGTAGG + Intergenic
973633840 4:52843874-52843896 CCTGACCACCAATCTCAAGTCGG + Intergenic
974003469 4:56533218-56533240 CATGCCCCTGAACTTCAAGTGGG + Intronic
974286002 4:59868056-59868078 CATGACTATCAACCTCAAGTGGG - Intergenic
974454372 4:62107123-62107145 CTTGCCCACCACCATCAAGTAGG - Intergenic
975139779 4:70907207-70907229 TTGGGCCACCAACCTCAAGTTGG - Intronic
976215695 4:82713733-82713755 CATGACCACTAACCTCAATTGGG + Intronic
977200192 4:94106043-94106065 CATAGTCACCAACTTCTACTTGG - Intergenic
977685004 4:99837376-99837398 CACACCCACCCACTTCAAGTAGG - Intronic
977800733 4:101227715-101227737 CCTCCCCACCACCTTCAAGTAGG + Intronic
978052555 4:104220257-104220279 CATCACCACAAACTTCAGGTGGG - Intergenic
978724773 4:111957089-111957111 CTTGGCCATTAACTTCAAGTTGG + Intergenic
980456578 4:133051894-133051916 CACAGCCTCCATCTTCAAGTAGG - Intergenic
980660172 4:135847688-135847710 CTTATCCACCAACATCAAGTCGG + Intergenic
982219648 4:153113627-153113649 CATGGCCACAAACCTCTAATGGG + Intergenic
982729727 4:158943392-158943414 CCTGGCCTCTAACTTCAAGTGGG + Intronic
984337153 4:178407582-178407604 CCTGCCCTCCACCTTCAAGTGGG - Intergenic
985197625 4:187449158-187449180 CATGACCATTAACCTCAAGTTGG + Intergenic
985652082 5:1111970-1111992 CATGCCCACCAACTTCACCGTGG - Exonic
988941583 5:36152807-36152829 CGTTGCCACCAGCTTCACGTGGG + Exonic
988995355 5:36709735-36709757 TATGGCTACCAACTTGGAGTAGG - Intergenic
989828592 5:45889084-45889106 CATGACCACTAAGTTCAAGAGGG + Intergenic
991772336 5:70051704-70051726 CATGACCACGAATCTCAAGTAGG - Intronic
991851629 5:70927122-70927144 CATGACCACGAATCTCAAGTAGG - Intronic
992040258 5:72823811-72823833 CATGGCCACAAACCTTAAGTGGG + Intronic
995020998 5:107367305-107367327 CCAGGCCACCAACTTCAACTTGG - Intergenic
995441435 5:112196775-112196797 CATGTTCATTAACTTCAAGTGGG + Intronic
996346129 5:122490577-122490599 CATGACCACCAGCTTAGAGTAGG + Intergenic
1001148431 5:169204870-169204892 CATGACCACTAACCTCAAATGGG - Intronic
1003830394 6:10003675-10003697 CCTGTCCTCCACCTTCAAGTAGG - Intronic
1004260083 6:14100481-14100503 TATGGCCATAAAATTCAAGTGGG - Intergenic
1005027337 6:21476041-21476063 CATGGTCACTAACTTCAGCTAGG + Intergenic
1005339696 6:24831578-24831600 CAAGGTCACCTACTTCTAGTGGG + Intronic
1008154765 6:48000468-48000490 CATGAACACAAGCTTCAAGTGGG + Intronic
1009446463 6:63748336-63748358 CTTGTCCACCAAAATCAAGTAGG - Intronic
1010395872 6:75391340-75391362 CATGGTCACTAACTTTAACTGGG + Intronic
1012707932 6:102558024-102558046 CATGACAACAAACTTCAAGAAGG + Intergenic
1013396718 6:109748165-109748187 CATGATCACCAACTTGAAATTGG - Intronic
1013915717 6:115334869-115334891 CTTGGCCACCATCTTAAAGTGGG + Intergenic
1014940976 6:127438041-127438063 CATGGCCACCATCTTTAACTAGG + Intergenic
1015591358 6:134826019-134826041 CATGGCAACCAACTCTAACTTGG + Intergenic
1018215771 6:161526179-161526201 CATGTTCAGCAACTTCATGTTGG - Intronic
1019529959 7:1498504-1498526 CCTGGGCACCACCATCAAGTTGG - Exonic
1025188621 7:56880458-56880480 CATGCCCAGCCCCTTCAAGTGGG - Intergenic
1025227444 7:57177709-57177731 CATGACCAACACCTCCAAGTGGG - Intergenic
1025683309 7:63696462-63696484 CATGCCCAGCCCCTTCAAGTGGG + Intergenic
1027289135 7:76683817-76683839 CATGACCACAGACCTCAAGTAGG + Intergenic
1027740008 7:81989617-81989639 CATGACCTCTAACCTCAAGTGGG - Intronic
1028602613 7:92618367-92618389 CATGGCCACCATATTGCAGTAGG - Intronic
1029062617 7:97814124-97814146 CTTGTCCACCAAGATCAAGTTGG + Intergenic
1030190550 7:106806209-106806231 AATGGCCATAAACCTCAAGTGGG - Intergenic
1032886294 7:136142785-136142807 CATGGCCATAAACCTCAAGTGGG + Intergenic
1033108208 7:138550160-138550182 CATGACCACTTACTTCAGGTAGG - Intronic
1036096156 8:5726479-5726501 CATGGCCAGCCACTTCCAGAAGG - Intergenic
1037570411 8:20153163-20153185 TATGGCCACAAACCTAAAGTGGG - Intronic
1038607726 8:29025815-29025837 CATGACCGCTAACCTCAAGTGGG + Intronic
1039946821 8:42136955-42136977 CATGGCCACCAATTGCAGGGTGG - Intergenic
1040571856 8:48618491-48618513 CAAGGACAACAACTTCAAATAGG + Intergenic
1040716168 8:50255499-50255521 CATGGCCAGCAACTTGATTTTGG - Intronic
1041838091 8:62240016-62240038 CTTGACCACCATCTTCAAGTTGG - Intergenic
1042769585 8:72365234-72365256 CATGACCATGAACTTCAAGTGGG + Intergenic
1043279754 8:78448633-78448655 CTTGTCCACCAAGATCAAGTTGG + Intergenic
1044601560 8:94010225-94010247 CATGCCCACCATCTTTAAGTAGG - Intergenic
1044958404 8:97505383-97505405 CATGGCCATTAACTTCAAGTGGG - Intergenic
1046553882 8:115752195-115752217 CAAGGCCACCCACTTCCAGGTGG + Intronic
1049485172 8:142853720-142853742 CTTAGCCACCAAGATCAAGTTGG + Intronic
1049903923 9:198161-198183 CTTGTCCACCAGCTTCAACTGGG + Intergenic
1052273391 9:26651486-26651508 TATGACCACCAACCTCAAATGGG + Intergenic
1053746933 9:41208462-41208484 CTTGTCCACCAGCTTCAACTGGG + Intergenic
1054480352 9:65656897-65656919 CTTGTCCACCAGCTTCAACTGGG - Intergenic
1054681411 9:68222819-68222841 CTTGTCCACCAGCTTCAACTGGG - Intergenic
1058315114 9:103554994-103555016 CAAGGACACCAACTTCAAAATGG + Intergenic
1058599322 9:106652465-106652487 CCTGTCTACCAAATTCAAGTAGG - Intergenic
1059762888 9:117355802-117355824 CATGGCCCCCAGCTGCAAGCCGG - Intronic
1202783064 9_KI270718v1_random:19242-19264 CTTGTCCACCAGCTTCAACTGGG + Intergenic
1185916111 X:4037220-4037242 CATGACAACAAACCTCAAGTAGG + Intergenic
1186260537 X:7774184-7774206 TATGGCCCCAAACTTCAGGTAGG - Intergenic
1188257438 X:27980269-27980291 CATGTCCACCCACTGCAAATTGG + Exonic
1189166175 X:38863385-38863407 CATGACCACAAACTTGAAGTAGG - Intergenic
1189513467 X:41686653-41686675 CATGACTACAAACCTCAAGTGGG - Intronic
1189911116 X:45811310-45811332 CATGGCCACCAAACTCAAATGGG + Intergenic
1190388669 X:49910438-49910460 CAAGCCCACAAACCTCAAGTGGG + Intergenic
1190787119 X:53662476-53662498 CATGACAACCCACCTCAAGTTGG + Intronic
1191174588 X:57485345-57485367 CATGGCCACAGTCTTCAAGCAGG + Intronic
1194784459 X:98064674-98064696 CATGACCACTAACCTCAAGTGGG - Intergenic
1195768325 X:108320264-108320286 CATGACCACCAAATTCAAGTGGG - Intronic
1195959093 X:110366805-110366827 CAGGACCACTAACTTCAAATGGG + Intronic
1197081073 X:122417783-122417805 CATGGCCTCCAGTTTCAAGCAGG - Intergenic
1199131875 X:144198724-144198746 CATACCCTCCACCTTCAAGTAGG + Intergenic