ID: 912506232

View in Genome Browser
Species Human (GRCh38)
Location 1:110158420-110158442
Sequence TCCAGGGCGTTGTGGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912506222_912506232 9 Left 912506222 1:110158388-110158410 CCTTGGGCTTGCACGTGCATGTC 0: 1
1: 0
2: 0
3: 13
4: 96
Right 912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG 0: 1
1: 0
2: 1
3: 6
4: 134
912506216_912506232 28 Left 912506216 1:110158369-110158391 CCCTGTCAGCCCACTGTGTCCTT 0: 1
1: 0
2: 3
3: 21
4: 264
Right 912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG 0: 1
1: 0
2: 1
3: 6
4: 134
912506217_912506232 27 Left 912506217 1:110158370-110158392 CCTGTCAGCCCACTGTGTCCTTG 0: 1
1: 0
2: 1
3: 18
4: 176
Right 912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG 0: 1
1: 0
2: 1
3: 6
4: 134
912506221_912506232 18 Left 912506221 1:110158379-110158401 CCACTGTGTCCTTGGGCTTGCAC 0: 1
1: 0
2: 1
3: 21
4: 210
Right 912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG 0: 1
1: 0
2: 1
3: 6
4: 134
912506220_912506232 19 Left 912506220 1:110158378-110158400 CCCACTGTGTCCTTGGGCTTGCA No data
Right 912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG 0: 1
1: 0
2: 1
3: 6
4: 134
912506215_912506232 29 Left 912506215 1:110158368-110158390 CCCCTGTCAGCCCACTGTGTCCT No data
Right 912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG 0: 1
1: 0
2: 1
3: 6
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912506232 Original CRISPR TCCAGGGCGTTGTGGGATGT GGG Intronic
903083315 1:20831324-20831346 TCCTGGGCAATGTGGGATGGAGG + Intronic
905362453 1:37430184-37430206 TGCAGGGCCTTGTAGGAGGTAGG - Intergenic
905600891 1:39249756-39249778 TCTAGGACGTTGTTGCATGTTGG + Intronic
907491792 1:54813252-54813274 ACCAGGCTGCTGTGGGATGTTGG - Intronic
908330212 1:63063603-63063625 TCCTGTGCATTATGGGATGTTGG - Intergenic
912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG + Intronic
912594332 1:110859058-110859080 TCCAGGTCACTGAGGGATGTAGG + Intergenic
917001574 1:170367146-170367168 TCCAGGCAGTGGTGTGATGTGGG + Intergenic
918057708 1:181036413-181036435 TCCTGGGCTTTGAGGGATATTGG + Intronic
919769210 1:201146567-201146589 TCCAGGAAGGTGTGGGATGTGGG + Intronic
922573692 1:226648140-226648162 TGCAGGGCGGTGTGCGGTGTTGG - Intronic
923220829 1:231891574-231891596 TCCAGTGGGCTCTGGGATGTAGG + Intronic
1064791007 10:18958121-18958143 TCCAGGCCCCCGTGGGATGTGGG + Intergenic
1067566939 10:47346298-47346320 CCCAGGCCGTGGGGGGATGTAGG - Intergenic
1067901220 10:50243763-50243785 TCCTGGGCAATGTGGGATGGAGG - Intronic
1070501488 10:77076816-77076838 TCTAGGGCCTAGAGGGATGTAGG - Intronic
1071443221 10:85722914-85722936 TCCAGGGCAGTGTGGTATGATGG - Intronic
1073139321 10:101237116-101237138 CCCAGGGACTTGTGGGAAGTGGG - Intergenic
1074416506 10:113271961-113271983 GCCAGGGGGTTGTGGGGTGAGGG + Intergenic
1075221876 10:120592165-120592187 CCCTGGGAGCTGTGGGATGTCGG + Intergenic
1075262721 10:120977019-120977041 TGCAGGGCATTGTGGTAGGTAGG - Intergenic
1081847910 11:46253824-46253846 TCCAGGAGGTGGTGGGATCTGGG - Intergenic
1082720156 11:56664469-56664491 TCCAGGGAGTAGCTGGATGTTGG - Exonic
1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG + Intergenic
1085037759 11:73309965-73309987 TCTAGGGCATTGAGGGATGGAGG + Exonic
1086633956 11:89060069-89060091 TCCAGTGAGTTGTAGTATGTTGG - Intronic
1088939538 11:114439550-114439572 TCCAGGCTGTTGCGGGGTGTAGG + Exonic
1091635141 12:2191154-2191176 GCCAGGGAGATGTGGGGTGTGGG + Intronic
1096416816 12:51421620-51421642 TCCAGGGGAGTGGGGGATGTGGG + Intronic
1098522764 12:71452012-71452034 TTCAGTGTGCTGTGGGATGTAGG - Intronic
1100113725 12:91277208-91277230 TCTAGGGTTTTGAGGGATGTGGG - Intergenic
1106024105 13:25940799-25940821 TCTAGGGCCTTGTTGGATGCTGG + Intronic
1111542136 13:89682727-89682749 TCCAGGGCCTGGTAGGGTGTGGG + Intergenic
1112999789 13:105620865-105620887 TCCTGTGCATTGTGGGATTTGGG - Intergenic
1122196024 14:100086523-100086545 TCCAGGGCGTAGTAGGAAGACGG + Intronic
1127797113 15:62448066-62448088 TCCAAGGCGTTGGGGCCTGTTGG - Intronic
1130105937 15:80928565-80928587 TCCAGGGCTTAGTGTGAGGTTGG - Intronic
1130178939 15:81606016-81606038 GCCAGGGCAGTGTGCGATGTTGG + Intergenic
1130677898 15:85969969-85969991 ACCAGGGCCTGATGGGATGTAGG - Intergenic
1130728165 15:86462589-86462611 TCCAGGGCCTGTTGGGAGGTGGG - Intronic
1130910080 15:88264860-88264882 CCCAGGGAGTTCTGGGATGGGGG + Intergenic
1132215054 15:100056427-100056449 ACCAGGGGGTTGGGGGAAGTGGG + Intronic
1135475023 16:22766319-22766341 TTCAGGTCCTTGTGGGCTGTTGG - Intergenic
1136022630 16:27449702-27449724 TCCGGGGCTTTGTGGGATCAGGG + Exonic
1138058346 16:53860303-53860325 TCCAAGGGTTTGAGGGATGTTGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142151401 16:88514188-88514210 TCTAGGGCACTGTGGGGTGTAGG - Intronic
1143659341 17:8315165-8315187 TCCAGGGGGTCGTGGGAAGGTGG - Exonic
1144042942 17:11429131-11429153 TCCAGTTCCTTGTGGGCTGTTGG + Intronic
1147548751 17:41423001-41423023 TCCAAGGTGGTGTGGGAGGTAGG - Intronic
1147550708 17:41439427-41439449 TCCAAGGTGGTGTGGGAGGTAGG - Intronic
1148154266 17:45413699-45413721 TCCAGGGCGGGGTGGGAGCTGGG + Intronic
1150207010 17:63416785-63416807 TCCAGGGTGCTGAGGGAAGTGGG + Intronic
1152923808 17:83078886-83078908 TCCTGCGCATGGTGGGATGTTGG - Intergenic
1160668209 19:343568-343590 TCTTGGGCGTTGTGGGAGGCAGG - Intronic
1161044030 19:2124977-2124999 TCCAGGGACTTGTGGGAGGTGGG + Intronic
1161208967 19:3056538-3056560 TCCAGGGCGGGCTGGGATGCTGG - Intronic
1161331973 19:3692784-3692806 TGCAGGGCCTTGTGGGCTGCAGG - Intronic
1161492125 19:4567830-4567852 TACAGGGCCTTGTGGGCTGCAGG - Intergenic
1161778790 19:6278413-6278435 TCCAGAGCGTTTAGGGAGGTTGG + Intronic
1161851923 19:6741733-6741755 TCCAGGGCTTTTTTGGATTTTGG - Intronic
1162412363 19:10514220-10514242 TCCTGGCCTTTGTGGCATGTTGG - Exonic
1162536431 19:11265223-11265245 TGCTGGGCCTTGTGGGTTGTGGG - Intergenic
1163411547 19:17158075-17158097 TCCTGTGCGCTGTGGGGTGTTGG - Intronic
1163787228 19:19281073-19281095 TACAGGGCACTGAGGGATGTGGG + Intronic
1165491841 19:36128062-36128084 TGCGGGGGATTGTGGGATGTAGG + Intergenic
1166531327 19:43545274-43545296 TGCAGGGAGTTGTGGGATGAGGG - Intronic
1167482290 19:49740334-49740356 ACCAGTGCATTGTGGGATGCTGG - Intronic
1168007686 19:53504455-53504477 TCCAGGGCGGTGTGGGTGGAGGG - Intergenic
928499890 2:31879956-31879978 TTAAGGGAGTGGTGGGATGTGGG - Intronic
931369334 2:61647777-61647799 TCCTGTGCATTGTAGGATGTTGG + Intergenic
931575621 2:63715136-63715158 TCTAGGGCCTTGTGGTAAGTGGG + Intronic
933685275 2:85136425-85136447 TCCAGGCCCGTGTGGGATTTTGG + Intronic
935424204 2:102902915-102902937 CCCAGGGCATTGTGGGAAGTCGG + Intergenic
941055223 2:160779974-160779996 TCCAGGGCTTTTTTGGTTGTTGG - Intergenic
941105456 2:161346811-161346833 TCCAGTGCTGTGTGGGAGGTAGG + Intronic
947314748 2:228843817-228843839 ACCAGGGCGTTGTGGGGTTGGGG + Intergenic
1172934349 20:38609134-38609156 TCCAGGGAGTAGTGGGTAGTGGG + Intronic
1173726409 20:45301285-45301307 TCCAGGGTGTGGTGGGAGGGTGG + Intronic
1173754218 20:45500542-45500564 TCCAGGGCCCTGTGTGATTTGGG + Intergenic
1174296813 20:49551243-49551265 TTCAGGCCGTGGTGGGAAGTGGG + Intronic
1175152288 20:56944584-56944606 TCCAGGGCCTTGACGCATGTGGG + Intergenic
1175205468 20:57307974-57307996 ACCAGGGAGCAGTGGGATGTGGG - Intergenic
1179976691 21:44872610-44872632 TCCAGGGCCTGGTGGGCTGCGGG - Intronic
1181089842 22:20465058-20465080 TCCAGTGCGTTGTGGGCTTCGGG - Exonic
1181593099 22:23896571-23896593 GCCAGGGCTTGGTGGGGTGTGGG - Intronic
1181956722 22:26592637-26592659 TGCAGAGCTTTGTGGGCTGTGGG + Intronic
1184688702 22:46107879-46107901 ACCAGGGCTTTCTGGGGTGTGGG - Intronic
951832736 3:26948809-26948831 ACCAGGGCCTGTTGGGATGTGGG + Intergenic
954108176 3:48420181-48420203 GCCAGGGCTTTGGGGGCTGTGGG + Exonic
954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG + Intronic
962821018 3:139047306-139047328 TCCAGGGCTGTGTTGGATGGTGG + Intronic
964087402 3:152834978-152835000 TCCAGGGCGCAGTGGGAAGCAGG - Exonic
968588724 4:1446993-1447015 GCGAGGGCTTGGTGGGATGTTGG - Intergenic
969503673 4:7570545-7570567 TACAGGGCGGTGTGGGAGGCAGG - Intronic
971909150 4:32772305-32772327 CCCAGGGCCTTCTGGGAAGTAGG + Intergenic
977736593 4:100424530-100424552 TGCAGTGCGTGCTGGGATGTGGG - Intronic
979197328 4:117935986-117936008 ACCAGGGCCTGTTGGGATGTGGG - Intergenic
984624121 4:181986592-181986614 CCTATAGCGTTGTGGGATGTTGG + Intergenic
985188475 4:187345248-187345270 TCCAGTGTGTTGTGGGATGTGGG - Intergenic
987135934 5:14899415-14899437 ACCAGGGCCTGTTGGGATGTGGG - Intergenic
990365073 5:55062254-55062276 TGCGGGGTGTGGTGGGATGTGGG - Intergenic
991271710 5:64791106-64791128 TCCAGGACCCTGTGGGATTTAGG - Intronic
993647338 5:90476734-90476756 TCCAGTGAGATGTGGGATGCAGG - Intronic
998386291 5:141758880-141758902 CCGAGAGCATTGTGGGATGTTGG + Intergenic
999453692 5:151697538-151697560 TCCAGGGCTCTGTGGGAAGGGGG + Intergenic
999663964 5:153893843-153893865 TCTAGGCTGTTGTGGGATCTGGG - Intergenic
1001516845 5:172361684-172361706 TGCAGGCTGTTGTGAGATGTGGG + Intronic
1003832144 6:10023180-10023202 TCAAGGGCGTGGTGGGAAGGAGG - Intronic
1006337669 6:33428826-33428848 TCCAGGGCGTGTCTGGATGTGGG + Intronic
1006457153 6:34138469-34138491 TTCTGGGAGATGTGGGATGTGGG - Intronic
1006517716 6:34553928-34553950 TCCTGGGCGTTGGGGGGTGGTGG - Intronic
1007758043 6:44113663-44113685 TCCAGAGCTTTCTGGGATGTGGG - Exonic
1011258785 6:85450573-85450595 TCCAGGGCGCGGAGAGATGTGGG + Intronic
1027931553 7:84541924-84541946 TGCAGGGGGTTGAGGGATGAAGG + Intergenic
1029799818 7:102934754-102934776 TCCAAGACATGGTGGGATGTAGG - Intronic
1034228710 7:149502168-149502190 TCCAGGGTGAGGAGGGATGTGGG - Intergenic
1034322956 7:150202152-150202174 TCTACGGGGTTGTGGGTTGTGGG - Intergenic
1034770226 7:153766961-153766983 TCTATGGGGTTGTGGGTTGTGGG + Intergenic
1034907549 7:154964053-154964075 ACCAGGGAGTTCTGGGAAGTGGG + Intronic
1035039767 7:155919427-155919449 TCCAAGCCCCTGTGGGATGTGGG + Intergenic
1036496276 8:9272646-9272668 TCCAGGAAGTTGTGGGATTAGGG + Intergenic
1037275650 8:17175221-17175243 GACAGGGCGTTGTGGGTTGCAGG + Intronic
1037303058 8:17473106-17473128 TTGAGGGCGTTGTGGGATGCTGG + Intergenic
1039844578 8:41316758-41316780 TCCAGGCCCCTGTGGGCTGTGGG - Intergenic
1044870850 8:96618509-96618531 ACCAGGGCCTTGGGGGATCTGGG + Intergenic
1047778281 8:128091431-128091453 GCCAGGGTGCTGTGTGATGTGGG - Intergenic
1049157587 8:141076322-141076344 TACAGGGTGCTATGGGATGTTGG + Intergenic
1049613232 8:143565449-143565471 TCCAGCGTGCTGTGGGGTGTGGG + Intergenic
1054697112 9:68371481-68371503 TGGAGGGGGTTGTGGGATTTGGG + Intronic
1054778713 9:69146799-69146821 TCCTGTACCTTGTGGGATGTTGG - Intronic
1055053589 9:72003374-72003396 TCAAGGGCATTGTGTTATGTGGG + Intergenic
1057274801 9:93670541-93670563 TGCAGGGGGTTGTGGGCGGTGGG + Intronic
1057288327 9:93779152-93779174 TCCAGGAGGTTGAGAGATGTGGG + Intergenic
1058413925 9:104764865-104764887 TCCCGGGAGTTGTGGCATTTAGG - Intronic
1059436864 9:114282384-114282406 TCCAGGGAGGGGAGGGATGTGGG - Intronic
1062023091 9:134328336-134328358 TCCACGGAGTTGGTGGATGTAGG + Intronic
1062151663 9:135022479-135022501 TCCAGGGTGTTGCCGGAAGTCGG - Intergenic
1185582454 X:1221451-1221473 TCCTGTGCATTGGGGGATGTGGG + Intergenic
1188180566 X:27050482-27050504 TGCAGGGCGGGGTGGGTTGTAGG - Intergenic
1190332246 X:49243070-49243092 TCCAGGGTGAAGTGGGATGAGGG - Intronic
1191880772 X:65842076-65842098 TCCAGAGTGTTGGGGGATTTCGG - Intergenic