ID: 912508569

View in Genome Browser
Species Human (GRCh38)
Location 1:110173144-110173166
Sequence AGAACCCAAGTAAAAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912508566_912508569 -8 Left 912508566 1:110173129-110173151 CCCACTTGGACTGAAAGAACCCA No data
Right 912508569 1:110173144-110173166 AGAACCCAAGTAAAAGAAGTGGG No data
912508567_912508569 -9 Left 912508567 1:110173130-110173152 CCACTTGGACTGAAAGAACCCAA 0: 1
1: 0
2: 2
3: 10
4: 131
Right 912508569 1:110173144-110173166 AGAACCCAAGTAAAAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912508569 Original CRISPR AGAACCCAAGTAAAAGAAGT GGG Intronic