ID: 912508569 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:110173144-110173166 |
Sequence | AGAACCCAAGTAAAAGAAGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912508566_912508569 | -8 | Left | 912508566 | 1:110173129-110173151 | CCCACTTGGACTGAAAGAACCCA | No data | ||
Right | 912508569 | 1:110173144-110173166 | AGAACCCAAGTAAAAGAAGTGGG | No data | ||||
912508567_912508569 | -9 | Left | 912508567 | 1:110173130-110173152 | CCACTTGGACTGAAAGAACCCAA | 0: 1 1: 0 2: 2 3: 10 4: 131 |
||
Right | 912508569 | 1:110173144-110173166 | AGAACCCAAGTAAAAGAAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912508569 | Original CRISPR | AGAACCCAAGTAAAAGAAGT GGG | Intronic | ||