ID: 912508732

View in Genome Browser
Species Human (GRCh38)
Location 1:110174237-110174259
Sequence GACCATTCCCACTGGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912508732_912508738 2 Left 912508732 1:110174237-110174259 CCCCTTCCCCAGTGGGAATGGTC 0: 1
1: 0
2: 1
3: 13
4: 141
Right 912508738 1:110174262-110174284 TTTTCCAGCCTATTTCTGACAGG 0: 1
1: 0
2: 3
3: 23
4: 316
912508732_912508741 26 Left 912508732 1:110174237-110174259 CCCCTTCCCCAGTGGGAATGGTC 0: 1
1: 0
2: 1
3: 13
4: 141
Right 912508741 1:110174286-110174308 TTGAATAAGACAGTGAGTGTAGG 0: 1
1: 0
2: 1
3: 24
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912508732 Original CRISPR GACCATTCCCACTGGGGAAG GGG (reversed) Intronic
901937750 1:12638433-12638455 GATCATTCCCAAAGGGAAAGAGG - Intergenic
903562369 1:24237415-24237437 CACCTTTCCTACAGGGGAAGGGG - Intergenic
905267361 1:36764035-36764057 GAGCAGTCACAGTGGGGAAGGGG + Intergenic
909927719 1:81458481-81458503 GAGATTTCCCACTGGGAAAGTGG - Intronic
912508732 1:110174237-110174259 GACCATTCCCACTGGGGAAGGGG - Intronic
915714171 1:157929061-157929083 GCCCATTTTCTCTGGGGAAGGGG - Intergenic
917613652 1:176715405-176715427 GACCACCCCCACTGGAGCAGGGG + Intronic
917968481 1:180193164-180193186 GATCATTCCAACTGGGGAAAAGG - Intronic
920519774 1:206614659-206614681 GATTGTGCCCACTGGGGAAGGGG - Intergenic
922761483 1:228134723-228134745 CACCATTCCCACTGGTCAAGTGG + Intergenic
1065617354 10:27541925-27541947 AACCATTGCTACTGGGGAAGTGG - Exonic
1066974662 10:42356583-42356605 CAAGATTCCTACTGGGGAAGAGG - Intergenic
1070742761 10:78913540-78913562 GACCATGCCATCTGGGGGAGGGG - Intergenic
1070749579 10:78955981-78956003 GCCCCTGCCCCCTGGGGAAGTGG - Intergenic
1072514721 10:96168267-96168289 CACCATTCCCACTGGCCAAGTGG - Intronic
1073176463 10:101560338-101560360 GGCCAACCCCACTGGGGAAAGGG - Intergenic
1073960441 10:108920823-108920845 GACCTCTCTCACTGGGGATGAGG - Intergenic
1074196776 10:111195855-111195877 GTCTATTCCCACTGGGGGAAGGG - Intergenic
1074709335 10:116164010-116164032 CACCATTCCCACTCCCGAAGAGG + Intronic
1076669260 10:132110773-132110795 GACCGTTCCCAGTGAAGAAGGGG + Intronic
1077400704 11:2355498-2355520 GGCCAGTACCACTGGGGGAGGGG - Intergenic
1083706246 11:64518365-64518387 GTTATTTCCCACTGGGGAAGGGG - Intergenic
1086059900 11:82689806-82689828 GACCATTCCCATCGGCCAAGTGG - Intergenic
1087405127 11:97721298-97721320 GCACATTCCCGCTGGGGAATTGG + Intergenic
1088537801 11:110880581-110880603 GTCCATTACCACTGGCGCAGGGG + Intergenic
1090307064 11:125700206-125700228 GAGCAGCCTCACTGGGGAAGTGG + Intergenic
1090894084 11:130953998-130954020 GACAATTCCCACGTGGGAAATGG - Intergenic
1092659320 12:10722379-10722401 GAGCATTTCCTTTGGGGAAGAGG - Intronic
1099103930 12:78477722-78477744 AAATATTCCCTCTGGGGAAGTGG + Intergenic
1103421493 12:120788162-120788184 GACCATTCCCAGTGCTGATGAGG - Intronic
1105051730 12:133059234-133059256 AAATATTCCCACTGGGGATGAGG + Exonic
1105230101 13:18486572-18486594 CAAGATTCCTACTGGGGAAGAGG - Intergenic
1109801873 13:67390587-67390609 CACTCTACCCACTGGGGAAGGGG - Intergenic
1111034735 13:82657478-82657500 GACAATTCAAAGTGGGGAAGGGG + Intergenic
1111669676 13:91313912-91313934 GATCATTACCACTGAGCAAGAGG + Intergenic
1113311535 13:109137996-109138018 GACTGTTCCCACTAGGGTAGAGG + Intronic
1113361603 13:109636481-109636503 GAAAAATCTCACTGGGGAAGAGG - Intergenic
1113891155 13:113736246-113736268 GACCAGCCCCAGTGGGGAGGAGG - Exonic
1114014350 14:18413384-18413406 CAAGATTCCTACTGGGGAAGAGG - Intergenic
1115049423 14:29039181-29039203 GACAATTTCCACAGAGGAAGGGG + Intergenic
1116255622 14:42550841-42550863 GAAGAGTCACACTGGGGAAGGGG - Intergenic
1117176879 14:53153783-53153805 CACCACTCCCACTGGGAAACTGG + Intergenic
1117407338 14:55417052-55417074 GTCCATTCCCTCTTGGGAAAGGG - Intronic
1118044311 14:61950132-61950154 AATCATTCCCAGTGGGGATGTGG - Intergenic
1120734038 14:88033740-88033762 GACTATTCCTCCTGGGGCAGAGG + Intergenic
1121382175 14:93482318-93482340 GCCCATTAACACTGTGGAAGTGG - Intronic
1122166275 14:99826606-99826628 GTCCATTCACAATGGGGCAGGGG - Intronic
1123933127 15:25181469-25181491 GACACTTGCCAATGGGGAAGGGG - Intergenic
1126271872 15:46828726-46828748 GTCCAGTGCCACTTGGGAAGGGG - Intergenic
1136078299 16:27832000-27832022 GAAAATGCCCACTGAGGAAGGGG - Intronic
1136147259 16:28322665-28322687 GCCCATACCCACTGGGGAGGTGG - Exonic
1139458609 16:67104369-67104391 GACCATTCCCAAGGGTGAACAGG + Intergenic
1140857913 16:78993923-78993945 CACTGTTCCCACGGGGGAAGCGG - Intronic
1143536518 17:7543680-7543702 GCCCATGTTCACTGGGGAAGTGG + Intergenic
1143777252 17:9207679-9207701 GACCATTGCCACTGGAGCCGCGG + Intronic
1144899675 17:18572999-18573021 GACCATTCCCATCGGCCAAGTGG - Intergenic
1145273131 17:21415115-21415137 GGCCATTCGCACTGGGAAGGCGG + Intronic
1146520265 17:33520818-33520840 GTCATTTCCCCCTGGGGAAGAGG - Intronic
1148860107 17:50600272-50600294 CACCATTCCCCCTGGGGATGGGG + Intronic
1154523304 18:15253267-15253289 CAAGATTCCTACTGGGGAAGAGG + Intergenic
1156253989 18:35377653-35377675 TACCATTCCCACTCCCGAAGTGG + Intergenic
1157306589 18:46521885-46521907 GAACATTCCCACTGGGTGGGTGG + Intronic
1157321063 18:46635008-46635030 GACCATTAGCACAGAGGAAGGGG - Intronic
1160011467 18:75109834-75109856 GACCAGTTCCACTAGAGAAGTGG + Intergenic
1160110681 18:76026947-76026969 GAACATTCCCACAGGGTATGAGG - Intergenic
1161520392 19:4720580-4720602 AACCACTCTCCCTGGGGAAGGGG - Intronic
1162098025 19:8322293-8322315 GACCATTCCCATCGGCCAAGTGG - Exonic
1163894343 19:20044399-20044421 GTCCATTTTCACTAGGGAAGAGG + Intergenic
1164503812 19:28841565-28841587 GGCCTTTCACACTGGGGAAGAGG + Intergenic
1167831807 19:52028960-52028982 AACCACTGCCAGTGGGGAAGGGG + Intronic
929550457 2:42887369-42887391 GACCACTTCCACTGTGGAAGGGG + Intergenic
931721213 2:65069054-65069076 GCCCAACCCCACTGGGTAAGAGG - Intronic
931785237 2:65612205-65612227 GACCCATCCCACTGGGGAGATGG + Intergenic
935333797 2:101996892-101996914 GCCCTTTCCCACTAGGGCAGGGG + Intronic
937013267 2:118580793-118580815 CATCATTTCCACTGGGGGAGGGG + Intergenic
937468029 2:122152048-122152070 GACTAATACAACTGGGGAAGTGG + Intergenic
938522607 2:132086139-132086161 CAAGATTCCTACTGGGGAAGAGG + Intergenic
945553428 2:211249678-211249700 GATTATTACAACTGGGGAAGTGG - Intergenic
947573782 2:231256344-231256366 GACCATTCCCATCGGCCAAGTGG - Intronic
947662880 2:231882868-231882890 CACCTTTCCCCCTGGGGAGGCGG - Intergenic
1168917324 20:1500779-1500801 GACCATGGCCAATGGGGAAAGGG + Intergenic
1171478034 20:25428731-25428753 AACCATTCACAATGGGGAAAGGG - Intronic
1174204847 20:48830687-48830709 CATCATTACCACTGGGGATGGGG - Intergenic
1175719495 20:61277155-61277177 GAAGATTCCCACAGGGGAAATGG - Intronic
1176774086 21:13114918-13114940 CAAGATTCCTACTGGGGAAGAGG - Intergenic
1178501456 21:33128985-33129007 GTCCATACCTACTGGGGTAGCGG - Intergenic
1179233491 21:39525896-39525918 GACCAAGCCAACTGGAGAAGAGG + Intergenic
1180438847 22:15344190-15344212 CAAGATTCCTACTGGGGAAGAGG - Intergenic
1180521710 22:16214639-16214661 CAAGATTCCTACTGGGGAAGAGG - Intergenic
1181080600 22:20412349-20412371 GGCCACTTCCACCGGGGAAGTGG - Intergenic
1183341534 22:37284425-37284447 AACTTTTCCCACTGGGGCAGAGG + Intronic
1183439006 22:37812695-37812717 GACAGTTCCCACTGAGGAACTGG - Intronic
949105515 3:197195-197217 GACCACCCCCACTGCGGACGAGG - Intronic
951908161 3:27723260-27723282 AACCTTTCCCACTGGGTAAAAGG - Intergenic
954089601 3:48273732-48273754 GAACATTCCCTCAAGGGAAGCGG + Intronic
954363441 3:50134295-50134317 GTCCACTCCACCTGGGGAAGGGG + Intergenic
954590559 3:51778325-51778347 GCCTACTCCCACTGTGGAAGGGG + Intergenic
954637737 3:52080458-52080480 GTCCATTCCCACTGTGGCTGAGG - Intronic
958634972 3:96732193-96732215 GCCCATTATCACTGGGGTAGAGG - Intergenic
961201107 3:125046250-125046272 GACCATACTCACTTGGGTAGGGG - Intronic
962484597 3:135830315-135830337 GATTGTTCCCAGTGGGGAAGGGG + Intergenic
962799541 3:138878543-138878565 GATCATTCCCACCAAGGAAGTGG - Intergenic
966120001 3:176510680-176510702 GACCATTGCCACTGAGGCAATGG + Intergenic
966816881 3:183896684-183896706 GACAATACACACTGGGGCAGGGG + Intergenic
966906131 3:184527100-184527122 GACCTTTCCTTCTGGGGATGGGG + Intronic
969198229 4:5580169-5580191 GCCCATTCCCAATAGGAAAGTGG + Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
971266005 4:25096596-25096618 GAACATTCCCACGGCGGCAGGGG + Intergenic
972277205 4:37568403-37568425 GCCCATTCCCAGTGGAGAAGGGG + Intronic
972705406 4:41538070-41538092 GCCCATTCCCTCTGAGGAAAAGG - Intronic
973575904 4:52289024-52289046 GACCATTCCCACTGGGTTAGAGG - Intergenic
980972844 4:139583107-139583129 GCCCAATCCCAGAGGGGAAGAGG + Intronic
984844803 4:184100375-184100397 GGACATTCCCACTGTGGAGGTGG - Intronic
985654567 5:1123243-1123265 CCACATTCCCTCTGGGGAAGTGG + Intergenic
991540876 5:67726758-67726780 GCCCATTGCCACTGCGGAGGAGG + Intergenic
992509848 5:77422013-77422035 TCCCATTCCCAGAGGGGAAGTGG - Intronic
997400861 5:133601119-133601141 GTTCATTCCCAGTGGGGACGTGG - Intronic
997622067 5:135305492-135305514 GCCCATGCCAACTGGGGAAGGGG - Intronic
1000630645 5:163586980-163587002 GAGCACTCCCAGTGGGGAATGGG - Intergenic
1001906701 5:175478900-175478922 GGCCCTTCCCACCGGGGACGAGG - Intronic
1003136442 6:3438254-3438276 GACCCATCCTGCTGGGGAAGGGG + Intronic
1006153910 6:32003939-32003961 GGCCTTTCCCACTGTGGCAGAGG + Intergenic
1006160218 6:32036676-32036698 GGCCTTTCCCACTGTGGCAGAGG + Intergenic
1007565003 6:42843213-42843235 GACCATCCCAACTGGGTTAGAGG - Intronic
1007655936 6:43450961-43450983 CACCATAGCCACTGGGGCAGAGG + Exonic
1017442308 6:154475422-154475444 GACCATTTCCACCGGGGAGGGGG - Intronic
1017542675 6:155418674-155418696 GACGCTTCCCACTGAGGAAGTGG + Intronic
1019705177 7:2494188-2494210 CCCCAGTCCCAGTGGGGAAGGGG + Intergenic
1020734485 7:11930138-11930160 GCAGATTCACACTGGGGAAGGGG + Intergenic
1021686550 7:23192598-23192620 GACCATTCACATAGTGGAAGTGG + Intronic
1035933997 8:3817175-3817197 GACCATTTTCATTGGGGAGGGGG - Intronic
1037971714 8:23176721-23176743 CTCCCTTCCCTCTGGGGAAGGGG + Intergenic
1039301364 8:36212411-36212433 GTTCTTTCCAACTGGGGAAGAGG - Intergenic
1040015712 8:42697479-42697501 GAGCATTTCCACTGGAAAAGGGG - Exonic
1040570652 8:48606141-48606163 CAGCACTCCCACAGGGGAAGAGG - Intergenic
1041719564 8:60964034-60964056 TACCATTCCCACTCCGGCAGCGG - Intergenic
1042372360 8:68006208-68006230 GACCATGCCTGCTGGGGAAGAGG - Intronic
1043273031 8:78357453-78357475 GACCTTTCCCATTGGGTATGGGG + Intergenic
1043535315 8:81196832-81196854 GACCATTCCAAGTGGGGGGGTGG - Intergenic
1047343564 8:124005763-124005785 GAGTAATCCCACTGGGGAGGAGG + Intronic
1047440397 8:124872457-124872479 AACCATGCCCTCTTGGGAAGAGG + Intergenic
1051840495 9:21392215-21392237 GCACATTCTCACTTGGGAAGAGG + Intergenic
1053701291 9:40693270-40693292 CAAGATTCCTACTGGGGAAGAGG + Intergenic
1054411355 9:64816726-64816748 CAAGATTCCTACTGGGGAAGAGG + Intergenic
1060140794 9:121208334-121208356 GTGCTTTCCAACTGGGGAAGGGG - Intronic
1061858674 9:133456797-133456819 GGCCAGTCCCAGTGGGGCAGTGG + Intronic
1061885138 9:133587561-133587583 GACCCTGCCCACTGGGTCAGAGG - Intergenic
1187573333 X:20528339-20528361 AAGGATTCCCAGTGGGGAAGGGG + Intergenic
1189558286 X:42166934-42166956 GAACACTGCCACTGAGGAAGTGG - Intergenic
1189931252 X:46013564-46013586 CACCATTCCCACTGTGGTTGTGG - Intergenic
1192209614 X:69119440-69119462 GCCCCTGCCCACTGGGGAAAAGG + Intergenic
1194976019 X:100396732-100396754 GCCCATCCCCACTGGGAAACCGG + Intronic
1195884510 X:109625060-109625082 GACCTTTCCCCCTGGGCGAGGGG + Exonic
1198707606 X:139465619-139465641 TACCATTGCCACTGGTAAAGGGG + Intergenic
1200116989 X:153773756-153773778 GCCCATGCCCAGTGGGGAGGAGG + Intronic
1202080685 Y:21081056-21081078 CACAATTCCCACTGTGGAAAGGG - Intergenic