ID: 912509252

View in Genome Browser
Species Human (GRCh38)
Location 1:110177067-110177089
Sequence GAAAACACTGGGCGTGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912509243_912509252 23 Left 912509243 1:110177021-110177043 CCATAGGACATTATAATCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 912509252 1:110177067-110177089 GAAAACACTGGGCGTGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912509252 Original CRISPR GAAAACACTGGGCGTGCTTG AGG Intronic
No off target data available for this crispr