ID: 912510405

View in Genome Browser
Species Human (GRCh38)
Location 1:110185810-110185832
Sequence CATTCTGTACTGAAGGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912510397_912510405 23 Left 912510397 1:110185764-110185786 CCCAGGAATCCTGGAAAGAGCCC 0: 1
1: 0
2: 2
3: 25
4: 197
Right 912510405 1:110185810-110185832 CATTCTGTACTGAAGGTGCCAGG No data
912510396_912510405 29 Left 912510396 1:110185758-110185780 CCATCACCCAGGAATCCTGGAAA No data
Right 912510405 1:110185810-110185832 CATTCTGTACTGAAGGTGCCAGG No data
912510402_912510405 2 Left 912510402 1:110185785-110185807 CCCTTTAAATGCAAGGAACAATA 0: 1
1: 0
2: 3
3: 26
4: 326
Right 912510405 1:110185810-110185832 CATTCTGTACTGAAGGTGCCAGG No data
912510399_912510405 14 Left 912510399 1:110185773-110185795 CCTGGAAAGAGCCCCTTTAAATG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 912510405 1:110185810-110185832 CATTCTGTACTGAAGGTGCCAGG No data
912510403_912510405 1 Left 912510403 1:110185786-110185808 CCTTTAAATGCAAGGAACAATAA No data
Right 912510405 1:110185810-110185832 CATTCTGTACTGAAGGTGCCAGG No data
912510401_912510405 3 Left 912510401 1:110185784-110185806 CCCCTTTAAATGCAAGGAACAAT No data
Right 912510405 1:110185810-110185832 CATTCTGTACTGAAGGTGCCAGG No data
912510398_912510405 22 Left 912510398 1:110185765-110185787 CCAGGAATCCTGGAAAGAGCCCC No data
Right 912510405 1:110185810-110185832 CATTCTGTACTGAAGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912510405 Original CRISPR CATTCTGTACTGAAGGTGCC AGG Intronic
No off target data available for this crispr