ID: 912511809

View in Genome Browser
Species Human (GRCh38)
Location 1:110194883-110194905
Sequence CTCCAGCTGTGTCCCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912511809_912511814 17 Left 912511809 1:110194883-110194905 CCCACACTGGGACACAGCTGGAG 0: 1
1: 0
2: 4
3: 33
4: 340
Right 912511814 1:110194923-110194945 GTGATTAGCACTCACAAGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912511809 Original CRISPR CTCCAGCTGTGTCCCAGTGT GGG (reversed) Intronic
900345583 1:2208798-2208820 CTCCAGCTCTGTGCCAGGCTAGG + Intronic
900387397 1:2416843-2416865 CTCTGCCTGTGTCCCTGTGTTGG + Intergenic
902334792 1:15748608-15748630 CTTCAGCTGTTTCCCAGCCTGGG - Intergenic
902677336 1:18017970-18017992 CTCCAGCTGCGTACCAGTCCTGG - Intergenic
905104967 1:35558724-35558746 CTCCCTCTGTGTCCCTGTGGAGG + Intronic
905108925 1:35580312-35580334 CACATGCTGTGCCCCAGTGTGGG + Intronic
906134355 1:43485812-43485834 CTCAAGCAATGCCCCAGTGTTGG + Intergenic
906893067 1:49739029-49739051 ATCCAGCTTTGTTCCATTGTTGG - Intronic
907230700 1:52995872-52995894 CCTCAGCTGTGTACCAGTGGAGG - Intronic
909608663 1:77531712-77531734 CTCCACCTGTGGCCCAGTGCAGG - Intronic
910383701 1:86658562-86658584 GTCCAGCTTTGTTCCATTGTTGG - Intergenic
910822634 1:91367728-91367750 GTCCAGCTGTGTTCCATTGCTGG - Intronic
912511809 1:110194883-110194905 CTCCAGCTGTGTCCCAGTGTGGG - Intronic
912959961 1:114187644-114187666 TTCCAGCTTTGTCCCATTGCTGG + Intergenic
913098891 1:115545238-115545260 CTCCAACACTGTCCCAGGGTTGG - Intergenic
914705276 1:150165000-150165022 CTCCAGCTGTGTCTGACTGGAGG - Intergenic
918511946 1:185321664-185321686 CTCCACCTGTGCCCCTGTGCAGG - Intergenic
918541631 1:185638741-185638763 CTCCAGCTTTGTTCCATTGCTGG - Intergenic
918993957 1:191732182-191732204 CTCCACCTGCGGCCCGGTGTGGG + Intergenic
919663372 1:200269457-200269479 CTCCCACTGTGTGCCAGGGTTGG + Intergenic
921818179 1:219587304-219587326 CTCCAGCTGTGCCCCACCCTTGG - Intergenic
922046790 1:221952863-221952885 GTCCAGCTTTGTTCCATTGTTGG - Intergenic
924453923 1:244202938-244202960 CCCCAGCTCTGTCCCAAAGTTGG + Intergenic
1063183001 10:3623081-3623103 CTCCATCTGTGCCCCACTGAAGG - Intergenic
1063461126 10:6215623-6215645 CTGCGGCTCTGTCCCAGTGAGGG - Intronic
1064170679 10:13029456-13029478 GTCCAGCTTTGTTCCATTGTTGG - Intronic
1064914443 10:20441221-20441243 CTCCAGCTTTGTTCCATTGCTGG + Intergenic
1066755168 10:38704083-38704105 ATCCAGCTGTGTTCCATTGCTGG - Intergenic
1067378962 10:45754890-45754912 CCACAGCTGTGAGCCAGTGTGGG - Intronic
1067886664 10:50095553-50095575 CCACAGCTGTGAGCCAGTGTGGG - Intronic
1068266115 10:54652278-54652300 CTCCAGCTGAGTCTCAGGATTGG - Intronic
1068903771 10:62299607-62299629 CTCCAGCAGTTTCCCATTGTAGG - Intergenic
1069076285 10:64041693-64041715 CTCCGGGTGTGGCCCAGCGTCGG - Intergenic
1069090735 10:64196721-64196743 CTCCACCTGCGGCCCGGTGTGGG - Intergenic
1070477860 10:76847333-76847355 GTCCAGCTGTGTTCCATTGCTGG - Intergenic
1070749002 10:78952970-78952992 CTCCAGCTGTCTCCAAGTGTTGG - Intergenic
1071713450 10:88072289-88072311 ATCCATCTTTGTCCCAGTCTGGG - Intergenic
1071955071 10:90749041-90749063 CTGCAGCTGCATCCCACTGTGGG - Exonic
1072379906 10:94857544-94857566 ATCCAGCTTTGTTCCATTGTTGG + Intergenic
1072715184 10:97746963-97746985 CTACAGGTGTGAGCCAGTGTGGG + Intronic
1073485789 10:103818383-103818405 CTGCTGCTGTGTGCCAGAGTTGG - Intronic
1073582982 10:104684487-104684509 CTACATCTGTGTCCCAGGGGTGG - Intronic
1074193354 10:111157191-111157213 CTCCAGTTGTGTACCAGGCTTGG + Intergenic
1074317232 10:112370737-112370759 CTTCACCTGTGACCCAGTGCTGG + Intergenic
1075238642 10:120756958-120756980 CTCCAGCTCTGTGCCGATGTTGG + Intergenic
1076687938 10:132206516-132206538 CTCCCACTCTGCCCCAGTGTGGG + Intergenic
1077143684 11:1035668-1035690 CCCCAGGGGTGTCCCACTGTAGG - Intronic
1077380592 11:2235197-2235219 CTCCTCCTGTGTCACACTGTGGG - Intergenic
1077400748 11:2355681-2355703 CTCCTCCTGTGTCACACTGTGGG - Intergenic
1077496275 11:2887991-2888013 CTCCAGGTGTGTCCCTGGCTTGG - Exonic
1080180222 11:29416588-29416610 CTCCAGCTTTGTTCCATTGCTGG - Intergenic
1081257834 11:40919232-40919254 TTCCAGCTGTATCACAGTGTAGG + Intronic
1081324258 11:41726822-41726844 ATCCAGCTTTGTTCCATTGTGGG + Intergenic
1081329636 11:41788174-41788196 CTCCACTTGCGGCCCAGTGTGGG - Intergenic
1081988388 11:47324248-47324270 CTCCCCCTGTGCCACAGTGTCGG + Exonic
1082155340 11:48803443-48803465 ATCCAGCTTTGTTCCAGTGCTGG + Intergenic
1082269091 11:50149949-50149971 CTCCAGCTTTGTTCCATTGCTGG - Intergenic
1082562272 11:54632614-54632636 CCCCCGTTGTGTGCCAGTGTAGG - Intergenic
1082956528 11:58876307-58876329 GTCCAGCTTTGTCCCATTGCTGG + Intronic
1083877632 11:65532675-65532697 CTCCATCTGTGGCCCAGGTTGGG - Exonic
1084390255 11:68870793-68870815 CTCCTGCTGTTTCCCAGAGGAGG - Intergenic
1086130756 11:83399860-83399882 CTCAAGCTGTCTTCCTGTGTTGG + Intergenic
1087183654 11:95162597-95162619 CTCCAGCTGTGGCCCAGAGTTGG - Intergenic
1089443099 11:118532133-118532155 CTCCTGCTGTGTTCCAGGTTGGG + Exonic
1090228212 11:125084147-125084169 CCCCAGCTGTGCCCCAGTGCTGG - Intronic
1091319874 11:134641817-134641839 CTCCAGCTATGACCTAGTGGTGG - Intergenic
1091446175 12:545443-545465 CTCCAGCTGCTGGCCAGTGTGGG + Exonic
1092696986 12:11183274-11183296 CAACAGCTGGGTCCCAGGGTAGG + Intergenic
1092895082 12:13002563-13002585 CTGCAGCTGCATCCCACTGTGGG + Intergenic
1093267172 12:17016930-17016952 TTCCACCTGTATCACAGTGTAGG + Intergenic
1094523798 12:31218844-31218866 CTCCTGCTCTGTCGCAGTGGGGG - Intergenic
1094875758 12:34640644-34640666 ATCCAGCTTTGTTCCATTGTTGG - Intergenic
1095383050 12:41617381-41617403 CTGAAGCTTTGTCCCTGTGTAGG - Intergenic
1099450516 12:82801985-82802007 CTCCACCTGTGCCCCCGTGCAGG - Intronic
1103033103 12:117633877-117633899 CTCCAGACATGCCCCAGTGTGGG + Intronic
1103203512 12:119109844-119109866 GTCCAGCTTTGTTCCATTGTTGG + Intronic
1103419413 12:120768373-120768395 CTCCACCTGGGGCCCAATGTTGG - Exonic
1104231204 12:126886089-126886111 CTCCATCTATGTCCCTGTGAAGG - Intergenic
1104243438 12:127013925-127013947 CTGGAGCAGTGTCCCAGTCTCGG - Intergenic
1107098346 13:36560706-36560728 AACCATCTGTGTCCCAGTGCAGG - Intergenic
1107377651 13:39821793-39821815 TTCTAGCTGTGTCCCAGTGCAGG - Intergenic
1109761217 13:66832000-66832022 CTACAGCTGTGTGCCTGTATTGG + Intronic
1113276821 13:108740153-108740175 GTCCAGCTTTGTTCCATTGTTGG + Intronic
1114591182 14:23866138-23866160 CCCCAGATTTGTCCCAGTGGTGG - Intergenic
1116094385 14:40349046-40349068 ATCCAGCTGTGTTCCATTGCTGG - Intergenic
1116901035 14:50362307-50362329 CTCCACCTGTGGCCTGGTGTGGG + Intronic
1117986828 14:61395173-61395195 CTCAAGCTGAGCCCCAGTCTAGG - Intronic
1119261619 14:73241162-73241184 CTCCAGCTGTGGCCCATGTTGGG - Intronic
1119669977 14:76510829-76510851 TTCCACCTGTGTCCCAGACTCGG + Intergenic
1121253384 14:92515042-92515064 CTCCAGCTGTCCCCCAGTTCAGG - Intronic
1122643983 14:103179404-103179426 CCCCAGCTCTGGCTCAGTGTGGG - Intergenic
1122744553 14:103890164-103890186 CTCCAGCTGTCTCCTGCTGTGGG + Intergenic
1123190272 14:106562675-106562697 GTCCAGCTGTGTCCTGGGGTTGG - Intergenic
1123198048 14:106635858-106635880 GTCCAGTTCTGTCCCAGAGTTGG - Intergenic
1123431292 15:20219282-20219304 CCCCAGCTCTGTGGCAGTGTCGG - Intergenic
1124620406 15:31270806-31270828 CACCAACTGTGTCCCAGAGAAGG + Intergenic
1124915678 15:33970520-33970542 GTTCAGCTGTTTCTCAGTGTAGG - Intronic
1125682061 15:41537160-41537182 CTCCAGCAGTGTCTCCGTGTGGG + Exonic
1130530583 15:84745292-84745314 CTCCATCTATTTCCCACTGTGGG + Intergenic
1130741247 15:86602893-86602915 CTCCAGCAGTGGACCAGTGGAGG + Intronic
1130895654 15:88168662-88168684 GTCCAGCTGTGTCCCTGAGGTGG - Intronic
1131106112 15:89736078-89736100 ATACAGATGTGTCCCTGTGTGGG + Intronic
1132034278 15:98467972-98467994 CTCCAGGTGTGTCCTATTTTGGG - Intronic
1132480047 16:162865-162887 CTCCAGCTGTGACTCAGGGGTGG + Intronic
1137919078 16:52467896-52467918 CCCCAGCTGTGACCAAGTCTTGG + Intronic
1138168911 16:54830227-54830249 CTCCACCTGTGGCCCAGTGCAGG + Intergenic
1138542176 16:57695092-57695114 CTTCAGCTATAGCCCAGTGTGGG - Intronic
1142742298 17:1938107-1938129 CTCCAGCTCTGTCACACTGCTGG + Intronic
1143247652 17:5500086-5500108 AGCCAGCTGTGCCCCAGAGTTGG - Intronic
1143484170 17:7243934-7243956 TTCCGCCTGTGTCCCAGTCTGGG + Exonic
1144380981 17:14698090-14698112 CATCAGCTGGGGCCCAGTGTAGG - Intergenic
1144955853 17:19018437-19018459 CTCCAGCCCAGTCCGAGTGTAGG + Intronic
1145286098 17:21506845-21506867 CTCCTGCTGGGTCCCAGGGTGGG - Intergenic
1145391505 17:22459446-22459468 CTCCTGCTGGGTCCCAGGGTGGG + Intergenic
1145970797 17:28955389-28955411 CTCCTGCCCTGTCCCAGTGGAGG - Exonic
1146837338 17:36122578-36122600 CTCCTTTTGTGTCCCAGTCTTGG + Intergenic
1147034892 17:37672542-37672564 CTCCAGCTAGGGCCCAGTGGGGG - Intergenic
1147162902 17:38578374-38578396 CTCCAGATGCCTCCCAGAGTTGG + Intronic
1148243189 17:46013233-46013255 CTCCAGCAGTGGCCTTGTGTGGG - Intronic
1149333137 17:55606985-55607007 CTACAGCTGTCTCACAGTTTGGG + Intergenic
1149359433 17:55878332-55878354 ATCCAGCTTTGTTCCATTGTTGG + Intergenic
1149405540 17:56346489-56346511 CTCCAGCTCTGTGGCAGTCTTGG - Intronic
1151391817 17:73792328-73792350 CTCCAGCTCTGTGCACGTGTAGG + Intergenic
1151866505 17:76806527-76806549 CTCCACTTGCGGCCCAGTGTGGG + Intergenic
1153858007 18:9170722-9170744 CTCCAGCTTTGTTCCATTGCTGG + Intronic
1154942900 18:21132485-21132507 CTCCACCTGCGGCCCAGTGCGGG - Intergenic
1156296055 18:35791720-35791742 GTCCAGCTGTGTTCCATTGCTGG - Intergenic
1156498539 18:37542019-37542041 CTCCAGCAGTGGCACAGAGTGGG + Intronic
1156725198 18:40119078-40119100 TTCCAGCTTTGTTCCATTGTTGG + Intergenic
1157858309 18:51120917-51120939 CTCCACCTGTGGCCCAGTGCGGG - Intergenic
1158145610 18:54309107-54309129 CTCCAGCTTTGTTCCATTGCTGG + Intronic
1158396173 18:57079758-57079780 CATCAGTTGTGTCCAAGTGTTGG - Intergenic
1158556408 18:58478256-58478278 ATCTAGCTGTATCTCAGTGTGGG - Intergenic
1160682943 19:420282-420304 CTCCAGCTCTGTCCCAGGCCGGG + Intronic
1160750069 19:729795-729817 CACCAGCTGTGTCCCTGGGCTGG + Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161906809 19:7162923-7162945 CTCTTCCTGTGTCTCAGTGTCGG - Intronic
1162453172 19:10766832-10766854 CTCCTGCTGTGTGCCAGGCTGGG + Intronic
1162460028 19:10809511-10809533 CCTCAGCTGGGGCCCAGTGTGGG + Intronic
1162544590 19:11321135-11321157 CTCCAGCTGGGTGGCAGAGTAGG + Intronic
1163190758 19:15675031-15675053 GTCCAGCTGTGTCCCTCCGTGGG - Intronic
1163459089 19:17425485-17425507 CTCCCTCTGTGTCCCAGGCTGGG + Intronic
1164406135 19:27948687-27948709 ATCCAGCTTTGTCCCATTGCTGG + Intergenic
1165430199 19:35767775-35767797 CTCCATCTGAATCCCAGTGTCGG + Intronic
1165755607 19:38291069-38291091 CTCCACCTGTTTCCCGGTGAAGG + Intronic
1166829426 19:45629906-45629928 CTCCTGCTGGGTGCCACTGTGGG - Intronic
1166907092 19:46118929-46118951 CTGCAGCTGTGGCCCGGTTTAGG + Intergenic
1167331290 19:48858059-48858081 CTCCAGCTGTGTGCCACTGTGGG + Intronic
925057017 2:863872-863894 CCCCAGCTGTGTACCAGGGAAGG - Intergenic
926658878 2:15440633-15440655 ATCCAGCTTTGTCCCATTGCTGG - Intronic
927497550 2:23561027-23561049 CTCCAACTGTTTTCCAGTCTGGG - Intronic
927554949 2:24024744-24024766 CTCCTTCTGTGTCCCTGTCTTGG + Intronic
927921054 2:26971869-26971891 CTCCAGCTGTGTGTCTTTGTGGG + Intronic
928084374 2:28336677-28336699 CTCCAGCTCTTTCTCAGTGCTGG - Intronic
928149611 2:28813906-28813928 CTCCAGCTGTCTCCCAGATGAGG + Intronic
929601506 2:43207531-43207553 CACCAGCTTTGTCCAAGGGTGGG - Intergenic
931935735 2:67194827-67194849 CTCCAGCTTTGTTCCATTGCTGG + Intergenic
931973345 2:67615128-67615150 CTCCCTCTGTGTCCCACTCTGGG + Intergenic
933775569 2:85769400-85769422 CTGCAGCCGTGTGCCAGTGCTGG + Intronic
934219315 2:90067262-90067284 CGCCAGCTGGGTTCCTGTGTAGG + Intergenic
934299908 2:91770779-91770801 CTTCAGCTGTGCCCCATTGAAGG + Intergenic
934481048 2:94645082-94645104 CTTCATCTGTGTCCCCGTGAAGG + Intergenic
934623936 2:95833082-95833104 CTCCAGGTCTGGCCCAGTGAAGG - Intergenic
935845833 2:107164703-107164725 CTCCTGCTGTGTCCCCAGGTTGG - Intergenic
935853544 2:107249175-107249197 CTCCAGCTGTGTCTCCCTCTGGG + Intergenic
936996766 2:118423962-118423984 CTCCTGCTCTGTCCCAGTGCCGG - Intergenic
937205722 2:120235979-120236001 ATCCAGCTGTGTCCAAATGAGGG - Intergenic
940814149 2:158279253-158279275 GTCCAGCTTTGTTCCATTGTTGG - Intronic
940992914 2:160115636-160115658 CTCCAGCTTTGTTCCACTGCTGG - Intronic
942147873 2:173043937-173043959 CTCCAGCTGAGCCCCAATTTAGG - Intronic
944062965 2:195589070-195589092 CTCCCTCTGTCTCCCAGTCTGGG + Intronic
945390782 2:209262488-209262510 CTCCAGCTTTGTTCCATTGCTGG - Intergenic
946638580 2:221757865-221757887 CTCCATCTCTGCCACAGTGTTGG - Intergenic
948730533 2:239961080-239961102 CTCCAGCTGCATCACAGTGATGG - Exonic
948913853 2:241020318-241020340 CTTCTGCTGTCTCCCAGAGTTGG + Intronic
1169399590 20:5268522-5268544 CTCCTGCTTTGTCCCAGAGGAGG + Intergenic
1169541095 20:6600542-6600564 GTCCAGCTGTGACCCAGCTTTGG + Intergenic
1169874934 20:10286619-10286641 CTCCAGCTGTGCACCTATGTAGG - Intronic
1169912055 20:10655052-10655074 CTCCTGCTGTCTCCCATTGGTGG - Intronic
1171140397 20:22735765-22735787 ATCCAGCTTTGTCCCATTGCTGG - Intergenic
1171141722 20:22749385-22749407 CTCCATCTGAGTCCCGGGGTTGG - Intergenic
1172096112 20:32461250-32461272 CCCCAGCTGTGACCCAGCCTTGG + Intronic
1172654762 20:36529932-36529954 CCCCAGCTGGGTCTCAGGGTAGG - Intergenic
1173146160 20:40526337-40526359 CTCTGGCTTTGTCCAAGTGTTGG + Intergenic
1174393958 20:50234537-50234559 CTCCGGCTGTGACCCCGTGGTGG + Intergenic
1175291168 20:57876408-57876430 CTCCAGGTCTGTCTCTGTGTGGG + Intergenic
1175353509 20:58343769-58343791 GTCCAGCTGTATCCCAGATTAGG - Exonic
1176187931 20:63791658-63791680 CTCCTGCCCTGTCCCAGTGCTGG - Intronic
1176408134 21:6432867-6432889 CTGCACCTGTGTCCCTGTGAGGG + Intergenic
1178464905 21:32839154-32839176 CATCAGCTTTGTACCAGTGTAGG + Intergenic
1179683625 21:43041193-43041215 CTGCACCTGTGTCCCTGTGAGGG + Intergenic
1180199008 21:46213662-46213684 CCCCAGCTGCATCCCAGTGAGGG - Intronic
1180301320 22:11038609-11038631 CTCCAGCTGTGTTCCTGTAAAGG - Intergenic
1181565319 22:23733303-23733325 CTCCAGGTGTGTCCTAGGGTTGG + Intergenic
1181580943 22:23827757-23827779 TTGCAGCTGTCTTCCAGTGTGGG - Intronic
1181698259 22:24604875-24604897 CTTCAGCTGTGCCCCATTGAAGG + Intronic
1182162264 22:28134333-28134355 GTCCAGCTGTGTTCCATTGCTGG - Intronic
1182169299 22:28210260-28210282 ATCCAGCTGTGTTCCATTGCTGG - Intronic
1182470312 22:30544271-30544293 CTCCAGGTGTGTGGCAATGTGGG - Intronic
1183206969 22:36426344-36426366 GGCCAGCTGGGTCCCTGTGTGGG - Intergenic
1184206960 22:43011100-43011122 CTCCAGATGCGTCCCAGTGGTGG - Intronic
1184241514 22:43213365-43213387 CTCCAGCTTTCTCCCGGTGATGG - Intronic
1184751625 22:46489550-46489572 ACCCAGCTCTGTCCAAGTGTGGG - Intronic
1203331163 22_KI270738v1_random:90126-90148 ATCCAGCTTTGTCCCATTGCTGG - Intergenic
949137154 3:581514-581536 GTCCAGCTGTGTTCCATTGCTGG + Intergenic
949770071 3:7569005-7569027 CTCCACCTGCGCCCCTGTGTGGG + Intronic
950605076 3:14071207-14071229 ATCCAGCTTTGTCCCATTGGTGG - Intronic
953425664 3:42795461-42795483 ATCCACCTGCCTCCCAGTGTTGG + Intronic
953637666 3:44676570-44676592 CTCCAGGTGGGCCCCAGTGAGGG + Intergenic
954701079 3:52451211-52451233 CTCCAGCTGAGTCCTGGGGTTGG - Exonic
955975663 3:64476922-64476944 GTCCAGCTTTGTTCCATTGTTGG - Intergenic
959835712 3:110916455-110916477 GTCCAGCTTTGTTCCAGTGCTGG + Intergenic
960115276 3:113886268-113886290 TTCCACCTGTGTCCCAGTCTGGG - Intronic
961054586 3:123777499-123777521 CTCGAGCTGTGGCAGAGTGTGGG - Intronic
961431136 3:126884114-126884136 ATCCAGCTGTGTCCCAGTCAAGG - Intronic
962178001 3:133174800-133174822 ATCCAGCTTTGTTCCATTGTTGG - Intronic
962432895 3:135336716-135336738 CTCTAGTTGTTTACCAGTGTCGG + Intergenic
964393712 3:156223859-156223881 CTTCACCTGTGCCCCAGTGCGGG - Intronic
964953394 3:162324464-162324486 CTGAATCTGTGTCCCAGTGAGGG - Intergenic
965054830 3:163698814-163698836 CTGATTCTGTGTCCCAGTGTGGG + Intergenic
965845708 3:172958900-172958922 CTCCAACTGTGGCTGAGTGTGGG + Intronic
965954907 3:174358254-174358276 CACCAGCTGTTTCCCAGTGCAGG + Intergenic
968598925 4:1500129-1500151 CTCCAGCTGTGTGCAAGGCTGGG + Intergenic
969320816 4:6411382-6411404 CTCCTGCTGTGTGCCAGCCTGGG - Intronic
969722771 4:8901775-8901797 CTGCATCTGTGTCTCAGTGGGGG - Intergenic
969807258 4:9618717-9618739 GTCCAGCTTTGTTCCATTGTTGG - Intergenic
972175709 4:36402815-36402837 CTCCAGCAGGGTCCCATCGTAGG - Intergenic
973878186 4:55241868-55241890 CTCCACCTGCGGCCCAGTGTGGG + Intergenic
974143470 4:57918532-57918554 CTCCAGCTTTGTTCCACTGCTGG + Intergenic
974624863 4:64412109-64412131 TTCCAGTAGTGTCCCTGTGTAGG - Intergenic
975502253 4:75099949-75099971 CTCCACCTCTGTGGCAGTGTTGG + Intergenic
976475147 4:85475068-85475090 CTCGAGCTGTGTCTGAGGGTTGG + Intergenic
977089416 4:92651805-92651827 ATTCAGCTATGTCCCAGAGTGGG + Intronic
977307567 4:95343233-95343255 ACCCAGCATTGTCCCAGTGTTGG + Intronic
978431717 4:108639880-108639902 CTACAGCTGTGTCCAAGAGCTGG - Intergenic
980135405 4:128853839-128853861 CCCCAGCTGTGGCCCAGTCCTGG + Intronic
980217885 4:129875757-129875779 GTCCAGCTTTGTTCCATTGTTGG + Intergenic
981254887 4:142649338-142649360 CTCCAGCTTTGTTCCATTGCTGG - Intronic
982125183 4:152178093-152178115 CTTCAGGGGTGTCCCAGGGTGGG - Intergenic
982196278 4:152918644-152918666 CTCCAGCTTTGACACAGTTTGGG - Intergenic
982863463 4:160482181-160482203 CTCCACCTGTGCCCCGGTGCAGG + Intergenic
983181128 4:164650168-164650190 GTCCAGCTTTGTCCCATTGCTGG - Intergenic
983995585 4:174177378-174177400 CCCCAGATGTGTCTAAGTGTTGG - Intergenic
984815247 4:183830428-183830450 CTACAGCTGTGTCCTTCTGTGGG + Intergenic
986057208 5:4150206-4150228 CTCTGGCTGTGTCCCAGAGGTGG + Intergenic
986681089 5:10233269-10233291 ATCAAGCTGTGTCTCAGTGGAGG - Intronic
987477094 5:18403855-18403877 CTCCAGCTATGTCCATGTGTTGG + Intergenic
988388940 5:30602311-30602333 CACCAGCTGCATCTCAGTGTTGG + Intergenic
988687722 5:33540951-33540973 ATCCAGCTTTGTTCCAGTGCTGG - Intronic
989442813 5:41492947-41492969 CTCCAGCTTTGTTCCATTGCTGG + Intronic
989562123 5:42863925-42863947 ATCCAGCTTTGTCCCATTGCTGG - Intronic
989950830 5:50295455-50295477 GTCCAGCTGTGTTCCATTGCTGG + Intergenic
990665644 5:58069086-58069108 CTCCGTCTGTGCCCCGGTGTGGG - Intergenic
992285066 5:75226403-75226425 CTCCACGTCTGTCCCAGTGGTGG + Intronic
992572282 5:78071250-78071272 CTCCAGCCATGTCCCTGTGAAGG - Intronic
993627145 5:90239377-90239399 ATCCAGCTGTGTTCCATTGCTGG - Intergenic
993902636 5:93595132-93595154 CTCCAACTGTCTCCCAGAGCTGG - Intergenic
994036859 5:95211692-95211714 GTCCAGCTTTGTCCCATTGCTGG + Intronic
994974201 5:106780692-106780714 ACCCAGCAGAGTCCCAGTGTTGG + Intergenic
995047505 5:107669379-107669401 TTCCAGCTGTGTGCCGGTCTCGG - Intronic
995692759 5:114845526-114845548 ATCCAGCTTTGTTCCATTGTTGG - Intergenic
996026420 5:118651150-118651172 CTGCAGTTCTTTCCCAGTGTAGG - Intergenic
999255176 5:150206007-150206029 GTCCTGCTGTGTCCCACTGGTGG + Intronic
1000577243 5:162989384-162989406 CACCAGCTGTGTCCCAGGAATGG - Intergenic
1001904529 5:175460853-175460875 GTCCAGCAATGTCCCAGTGAAGG + Intergenic
1002418368 5:179132585-179132607 CCCCAGCTGGGTGCCAGGGTGGG - Intronic
1002419930 5:179140134-179140156 CTCCCCCTGTGCCCCAGAGTGGG - Intronic
1202775497 5_GL000208v1_random:66265-66287 ATCCAGCTTTGTCCCATTGCTGG - Intergenic
1004497709 6:16180681-16180703 CTCCACCTGTGGCCCCGTGTAGG - Intergenic
1004883767 6:20032723-20032745 CTCCACCTGCGGCCCGGTGTGGG + Intergenic
1005059364 6:21761575-21761597 CTCCACCTGTGGCCCGGTGCGGG + Intergenic
1006620269 6:35359113-35359135 CCTCAGCTGTGTCCCAGTGCAGG - Intronic
1006899218 6:37489470-37489492 CCCCAGCTTTGTCCCAGGGAAGG - Intronic
1007556313 6:42769427-42769449 CTCCTACTGTGTACCAGGGTTGG - Intronic
1008230755 6:48983378-48983400 CTCCACCTGCGGCCCTGTGTGGG - Intergenic
1008562051 6:52733312-52733334 CTAGACCTCTGTCCCAGTGTGGG + Intergenic
1008582405 6:52918866-52918888 CTGAATCTGTGTCCCAGTGTGGG + Intergenic
1008872930 6:56292639-56292661 CTTCAGCTGTGTCCATGTGTTGG - Intronic
1009188444 6:60600939-60600961 GTCCAGCTTTGTTCCATTGTTGG - Intergenic
1010250925 6:73706300-73706322 ATCCAGCGGTGACCCAGTTTAGG - Intronic
1010333631 6:74654870-74654892 CTCCAGCTTTACTCCAGTGTGGG + Intergenic
1010654205 6:78492636-78492658 CTCCTGCTGTGACCCAGTAATGG - Intergenic
1010671853 6:78695431-78695453 CTCCAGCTTTGTTCCATTGCTGG - Intergenic
1011006129 6:82647457-82647479 CTATTGCTCTGTCCCAGTGTGGG + Intergenic
1011670017 6:89674407-89674429 CTCCAGTGCTGCCCCAGTGTAGG - Exonic
1012345177 6:98176893-98176915 TTCCAGCTTTTTCCCAATGTTGG - Intergenic
1012940576 6:105410388-105410410 ACCCAGCAGTGTCCCAGTGGTGG + Intergenic
1013189133 6:107787050-107787072 CTACAGCTGTCTCCCTGTGTCGG + Intronic
1014038498 6:116796629-116796651 CTTCAGTTGTGTTCCAGAGTAGG - Intronic
1014204131 6:118637462-118637484 CTCAAGCTGTCTGCCAGCGTTGG - Intronic
1014364521 6:120522974-120522996 CTCCAGCTGTGTGCTGGTGCTGG - Intergenic
1015390571 6:132676983-132677005 CTGCAACTGTGTCCAAATGTGGG + Intergenic
1017516771 6:155163319-155163341 CTTCTGCTGAGTCCCTGTGTTGG + Intronic
1019145491 6:169973064-169973086 CTCTGGCTGTGTCCCACTGCAGG + Intergenic
1019777337 7:2919630-2919652 CTCCAGCTGTCTATCAGTATGGG + Intronic
1019951623 7:4377754-4377776 TTGCAGCTGTGGCTCAGTGTGGG - Intergenic
1026209116 7:68287615-68287637 CTCCAGCTGGTTCCCAGTGGGGG - Intergenic
1026670027 7:72382192-72382214 TTCCAGCTGTGACCCAGTAATGG + Intronic
1027456294 7:78396030-78396052 CTCCAGCTCTAGCCCAGTGCTGG + Intronic
1028321477 7:89465365-89465387 ATCCAGCTTTGTTCCAGTGCTGG + Intergenic
1029459064 7:100685110-100685132 ATCCAGCTGAGTCCCGGGGTGGG - Exonic
1031935530 7:127731794-127731816 CTCCAGCAGAGCCCCAGTGACGG - Intronic
1032985035 7:137328418-137328440 GTTCATCTGTGTCCCACTGTTGG + Intronic
1033430827 7:141288142-141288164 CACCAGCTGTCTGCCAGAGTTGG - Intronic
1033902369 7:146158358-146158380 ATCCAGCTTTGTCCCATTGCTGG - Intronic
1035063656 7:156089702-156089724 TTCAAGCTGTGTCACTGTGTTGG - Intergenic
1035882136 8:3254888-3254910 ATCCAGCTTTGTTCCATTGTTGG + Intronic
1035974992 8:4300276-4300298 CCCCATCTGTGCCCAAGTGTAGG - Intronic
1036918405 8:12828042-12828064 TTCCAGCTGTGTAACAGTGTGGG + Intergenic
1040311196 8:46237723-46237745 CCCCAGGTCTGTCCCGGTGTTGG + Intergenic
1040608441 8:48958904-48958926 ATCCAGCTTTGTTCCATTGTTGG + Intergenic
1040690767 8:49935720-49935742 CTGCAGCTCTGGCCCAGTGTTGG + Intronic
1043535912 8:81204443-81204465 GTCCAGCTTTGTTCCATTGTTGG + Intergenic
1044279484 8:90339210-90339232 CTCCAGCTGAGCCTCAGTATGGG - Intergenic
1045293543 8:100853432-100853454 GTCCAGCTTTGTTCCATTGTTGG - Intergenic
1046608023 8:116391829-116391851 ATCCAGCTTTGTTCCATTGTTGG - Intergenic
1047124830 8:121948490-121948512 CTCCACCTGCGCCCCAGTGCGGG + Intergenic
1048093255 8:131263221-131263243 ATCCAGCTTTGTTCCATTGTTGG - Intergenic
1048406906 8:134132506-134132528 GTCCTGCTGTGTCCCTCTGTTGG + Intergenic
1049054747 8:140227118-140227140 CTCCAGCTCTGTTCCTGTATGGG - Intronic
1049359497 8:142205589-142205611 CTCCAGCTGTGCCCCACTGAGGG - Intergenic
1049553935 8:143273105-143273127 CTCCAGTGGTGTCCCAGCGCAGG + Intronic
1050329634 9:4532180-4532202 CTCCAGCTTTGTTCCATTGCTGG - Intronic
1050930088 9:11311936-11311958 ATCCAGCACTGTCCCAGTGGTGG - Intergenic
1052576645 9:30299677-30299699 CTCCACCTGCACCCCAGTGTGGG + Intergenic
1052645519 9:31229529-31229551 ATCCAGCTTTGTTCCATTGTTGG + Intergenic
1052700925 9:31937237-31937259 ATCCAGCTTTGTTCCATTGTTGG + Intergenic
1052992813 9:34531560-34531582 ATCCAGCTTTGTTCCATTGTTGG + Intergenic
1053015100 9:34657362-34657384 CTCCAGCTGGGTCCCACAGTAGG + Intronic
1053751626 9:41263024-41263046 CTCCAGCTTTGTTCCATTGCTGG + Intergenic
1053926554 9:43064989-43065011 CTTCATCTGTGTCCCCGTGAAGG - Intergenic
1054257150 9:62827353-62827375 CTCCAGCTTTGTTCCATTGCTGG + Intergenic
1054334166 9:63788372-63788394 CTCCAGCTTTGTTCCATTGCTGG - Intergenic
1056461433 9:86812999-86813021 CTCAAGCTGTTCCCCACTGTCGG - Intergenic
1057822051 9:98340071-98340093 CACCAGCTGTGTCCCGGGGTAGG + Intronic
1058379501 9:104362850-104362872 CTCCACCTGCGGCCCAGTGTGGG - Intergenic
1058383153 9:104401800-104401822 CTCCAGCTGAATCTCAGTGTTGG + Intergenic
1059328611 9:113520325-113520347 CTCCAGCTGTGTGCCAGCTCTGG + Intronic
1059332265 9:113543011-113543033 CTCCAGCTGGAGCCCAGGGTTGG + Intronic
1060444350 9:123674015-123674037 CAGCAGCTGTGGCCCAGTGCTGG - Intronic
1060992357 9:127856414-127856436 CTCCACCTGTGACCCAGGGCAGG - Intergenic
1062044398 9:134418374-134418396 CTTCATCTGTGTCTCCGTGTGGG + Intronic
1185617019 X:1428108-1428130 CGCCAGCTTTGTCCCTGGGTGGG + Exonic
1186662669 X:11684889-11684911 CTGCATCTGTGTCCTAGTGGTGG + Intergenic
1186820350 X:13281807-13281829 CTCCAGGTATGTTCCAGTCTAGG + Intergenic
1186838604 X:13462823-13462845 CTCCGACTTTGTACCAGTGTTGG + Intergenic
1189249298 X:39587622-39587644 CTTCAGAGGTGTCCCAGTGGGGG + Intergenic
1190921620 X:54858952-54858974 GTCCAGCTTTGTCCCATTGCTGG + Intergenic
1191772446 X:64775584-64775606 GTCCAGCTTTGTTCCATTGTTGG - Intergenic
1191855990 X:65627567-65627589 CTCCCCCTGGGTCCCATTGTGGG + Intronic
1192299591 X:69886115-69886137 CTCCCTCTGTGTCCCTGTGTGGG - Intronic
1192395023 X:70771886-70771908 CTCCAGGCGTGTCCCAGTTATGG + Intronic
1192406534 X:70891348-70891370 ATCCAGCTTTGTTCCATTGTTGG - Intronic
1192521081 X:71801717-71801739 ATCCAGCTGTGTTCCATTGCTGG + Intergenic
1192707088 X:73537852-73537874 CTCCTGCTGGGTCCCTGAGTGGG - Intergenic
1192755046 X:74038954-74038976 CTCCAGCTTTGTTCCACTGCTGG + Intergenic
1192802427 X:74479501-74479523 CTCCAGCTTTGTTCCATTGCTGG + Intronic
1193030933 X:76897312-76897334 ATCCAGCTGTGTTCCATTGCTGG - Intergenic
1193402710 X:81064760-81064782 TTCCAGCTTTGTTCCACTGTTGG - Intergenic
1194151537 X:90330772-90330794 CTCCATCTGTGTCCCAGCAAAGG - Intergenic
1194228122 X:91286982-91287004 CCCCAGCACTGTCCCAGTGGTGG + Intergenic
1195259304 X:103117058-103117080 CTCCACCTGTGGCCCTGTGCGGG - Intergenic
1195421497 X:104680070-104680092 ATCCAGCCTTTTCCCAGTGTAGG + Intronic
1195460206 X:105115698-105115720 CTCCACCTGCGGCCCAGTGCGGG - Intronic
1196273872 X:113743321-113743343 CACAAGCTGTGTCCCTGAGTTGG - Intergenic
1198140590 X:133798825-133798847 CCCCAGCTGTGTCCCAGTGAGGG - Intronic
1198408314 X:136339039-136339061 CTCCAGCTGTCTCTCAGAGGGGG + Intronic
1198932428 X:141875798-141875820 CACCAGCTGCCTCCCAGTCTAGG + Intronic
1198937775 X:141916813-141916835 CACCAGCTGCCTCCCAGTCTGGG + Intergenic
1199292446 X:146119975-146119997 ATCCAGCTTTGTTCCATTGTTGG - Intergenic
1200166062 X:154036190-154036212 GTCCAGGTGTGGCCCAGGGTGGG + Intronic
1200497899 Y:3907517-3907539 CTCCATCTGTGTCCCAGCAAAGG - Intergenic
1201347960 Y:13005338-13005360 ATCCAGCTGTGTTCCATTATTGG - Intergenic
1201570397 Y:15407232-15407254 ATCCAGCTGTGTTCCATTGCTGG - Intergenic
1202298247 Y:23383452-23383474 CTCCAGCTTTGTTCCATTGGTGG + Intergenic
1202331469 Y:23757390-23757412 GTCCAGCTTTGTCCCATTGCTGG - Intergenic
1202539301 Y:25912670-25912692 GTCCAGCTTTGTCCCATTGCTGG + Intergenic
1202572562 Y:26287147-26287169 CTCCAGCTTTGTTCCATTGGTGG - Intergenic