ID: 912513475

View in Genome Browser
Species Human (GRCh38)
Location 1:110203732-110203754
Sequence CAAGTTACTCCAAGTCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912513473_912513475 -1 Left 912513473 1:110203710-110203732 CCAGTTATCTATTGCTGTGTTCC 0: 1
1: 0
2: 7
3: 61
4: 276
Right 912513475 1:110203732-110203754 CAAGTTACTCCAAGTCTGAGCGG 0: 1
1: 0
2: 1
3: 23
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912513475 Original CRISPR CAAGTTACTCCAAGTCTGAG CGG Intergenic
900317988 1:2068972-2068994 CACGTTTCCCCAACTCTGAGGGG - Intronic
900637075 1:3671264-3671286 CATGCTACTCCAGGTCTGAGGGG - Intronic
903054240 1:20624280-20624302 CAAGTTACTCCAACATTTAGTGG + Intergenic
906806274 1:48781785-48781807 CAAGTTTCACCATGTCTGAAGGG - Intronic
907454721 1:54567951-54567973 GATTTTACTCCAAGTGTGAGGGG - Intronic
908117181 1:60951771-60951793 CAAGTTATTCCACTTCTGTGAGG - Intronic
909496751 1:76287446-76287468 CAAATAACTCCATTTCTGAGGGG - Intronic
912082413 1:105952633-105952655 CAAGCTACTCTCTGTCTGAGTGG + Intergenic
912513475 1:110203732-110203754 CAAGTTACTCCAAGTCTGAGCGG + Intergenic
914493769 1:148173566-148173588 CAAATTACTCCAAAACTTAGTGG - Intergenic
915523300 1:156461157-156461179 CAAGGTTGTCCAAGTGTGAGAGG + Intergenic
917843844 1:179004061-179004083 CAAGGTCCTCCACATCTGAGAGG - Intergenic
918285587 1:183051550-183051572 CAAGCTACTCCAAAGCTCAGTGG - Intronic
920013982 1:202890877-202890899 CAAGTAACTCCAAGCGTCAGAGG + Intergenic
920167440 1:204045724-204045746 CCATTGTCTCCAAGTCTGAGGGG + Intergenic
920280279 1:204838349-204838371 CACTTTACTCTAAGTCAGAGAGG - Intronic
920425278 1:205870140-205870162 TAATTTGCTTCAAGTCTGAGAGG + Intergenic
921560060 1:216646501-216646523 TAACTTGCTCCAAGTCTCAGAGG + Intronic
921819204 1:219597063-219597085 CAAATTACTCCAACACTTAGTGG - Intergenic
922684764 1:227630610-227630632 TAATTTGCTTCAAGTCTGAGAGG + Intronic
924071897 1:240289050-240289072 CAAGTTACACCAAAGCTTAGGGG - Intronic
1063303359 10:4873982-4874004 TAAGTCACTCCAAAACTGAGAGG + Intergenic
1064636420 10:17372733-17372755 CAAATTACTCCAAAACTTAGTGG + Intronic
1066228853 10:33412256-33412278 CAAGTTTCTGCACATCTGAGAGG + Intergenic
1067662226 10:48244752-48244774 CAAGATACTCCAAGTCTTGCCGG - Intronic
1068947615 10:62745250-62745272 CAATTTACGGCAACTCTGAGGGG - Intergenic
1070294499 10:75148280-75148302 CAAGTTACTGTAAGTCTTCGTGG + Intronic
1070649500 10:78224746-78224768 CAAGTTAGTCCAAGTACGAGTGG - Intergenic
1071049277 10:81427203-81427225 CAAATTCCTCCAAGTTAGAGGGG - Intergenic
1073519155 10:104110076-104110098 CAAGTTACTCTGAGTCTCAGAGG + Intergenic
1075518408 10:123128317-123128339 CAAATTACTCCAAAACTTAGTGG + Intergenic
1077596134 11:3533274-3533296 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1077928467 11:6706226-6706248 CAAGTTAATTCATGGCTGAGAGG + Intergenic
1079419855 11:20276101-20276123 CAAGCCACAGCAAGTCTGAGAGG - Intergenic
1079887081 11:26002518-26002540 TAATTTGCTTCAAGTCTGAGAGG - Intergenic
1079933810 11:26594510-26594532 TAATTTGCTTCAAGTCTGAGAGG + Intronic
1081357431 11:42129161-42129183 CAAATTACTTCAAGTATCAGAGG + Intergenic
1081601253 11:44496383-44496405 CAAGAAAGTCCAAGTCAGAGAGG - Intergenic
1081770058 11:45644673-45644695 CAAGTCACTCCAAAACTTAGTGG + Intergenic
1084223004 11:67696418-67696440 CAAATTACCCCAAAACTGAGAGG + Intergenic
1084252041 11:67907262-67907284 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1084820805 11:71688765-71688787 TAAGTCACTCCAAATCTCAGTGG + Intergenic
1085411609 11:76294288-76294310 CCAGCTACTCCAGGACTGAGAGG + Intergenic
1085843653 11:80041887-80041909 CCATTTCCTCCAAGTCTGAAAGG - Intergenic
1086065451 11:82738893-82738915 CAAATTACTCCAAAACTTAGTGG + Intergenic
1091144421 11:133265203-133265225 CAAGTTAGTCCAAGTATGAGTGG - Intronic
1092422307 12:8342054-8342076 CATGTCACTCCAAATCTCAGTGG - Intergenic
1092932118 12:13325993-13326015 AAAATTACTCCAAGTCTGGACGG - Intergenic
1093348490 12:18069194-18069216 TAATTTGCTTCAAGTCTGAGAGG - Intergenic
1095297517 12:40544039-40544061 CAAGTTGTTCCAAATCTGAAAGG - Intronic
1095576920 12:43751027-43751049 CAAGTCACTTCAAATCTTAGTGG + Intronic
1097057556 12:56258749-56258771 CCAGTTCCTCCTAGTCTGTGGGG - Intergenic
1098233849 12:68399309-68399331 CAAATTACTCCAAAACTTAGTGG - Intergenic
1100340676 12:93676831-93676853 CTAGTTACTCCTAGTCAGAAAGG - Intergenic
1100755431 12:97746128-97746150 CAAATTACTCCAAAACTTAGTGG - Intergenic
1101391697 12:104306568-104306590 CAAATGACACCAAGACTGAGAGG + Intronic
1101719789 12:107341417-107341439 CAAGTCAGTGCAAGACTGAGGGG + Intronic
1104851620 12:131878110-131878132 TAATTTGCTTCAAGTCTGAGAGG + Intergenic
1111806112 13:93042030-93042052 TAAGTTGCTTCAAATCTGAGAGG - Intergenic
1115123282 14:29962621-29962643 CAAGCTACTCCAAGACTTGGTGG - Intronic
1116965437 14:51010169-51010191 CCATGTACTACAAGTCTGAGAGG - Intronic
1118296683 14:64576413-64576435 CAAGTTACCCAGGGTCTGAGAGG + Intronic
1121660214 14:95629490-95629512 CAAATTACTCCAAACCTTAGCGG - Intergenic
1123569761 15:21592007-21592029 CAAGTATCTCCATCTCTGAGTGG + Intergenic
1123605871 15:22027326-22027348 CAAGTATCTCCATCTCTGAGTGG + Intergenic
1124585206 15:30998713-30998735 CAAGTGACTCCAAAACTGGGTGG - Intergenic
1126741529 15:51781414-51781436 CAAATTACTCCAAAACTTAGAGG + Intronic
1202978109 15_KI270727v1_random:319098-319120 CAAGTATCTCCATCTCTGAGTGG + Intergenic
1132466573 16:80140-80162 CTTCTTACTCCAAGTCTGATTGG - Intronic
1133204388 16:4224291-4224313 GAAGGCACTGCAAGTCTGAGGGG - Intronic
1133375974 16:5287528-5287550 CAAGTCACTCCAAATCTCAGTGG + Intergenic
1135513430 16:23109025-23109047 CAAGTTTCTCATAGTCAGAGAGG + Intronic
1136082983 16:27865036-27865058 CAGCTGACTCCAAGTCTAAGGGG - Intronic
1139484481 16:67248180-67248202 CAACTTTTTCCAAATCTGAGGGG - Intronic
1139582675 16:67882671-67882693 CTAGCTGCTGCAAGTCTGAGGGG - Exonic
1203085223 16_KI270728v1_random:1180687-1180709 CAAGAGGCTCCAAGTCTGATGGG + Intergenic
1142803104 17:2357246-2357268 CAAGGAACTGCAACTCTGAGTGG - Intronic
1144616333 17:16777794-16777816 CTAGTTTCTCCAATTCTGTGAGG - Intronic
1144896370 17:18537865-18537887 CTAGTTTCTCCAATTCTGTGAGG + Intergenic
1145135846 17:20406352-20406374 CTAGTTTCTCCAATTCTGTGAGG - Intergenic
1145765090 17:27453508-27453530 AAAGTTTCTCCACCTCTGAGGGG + Intergenic
1150129597 17:62660493-62660515 TAAGTTCCACCAAGTTTGAGGGG + Intronic
1152201719 17:78951139-78951161 CAAGTTACCCCAAAACTTAGAGG - Intergenic
1153459672 18:5319563-5319585 CAAACTACTACAAGTCTGGGTGG + Intergenic
1153774856 18:8443334-8443356 CAATTTACCCCAAGTCTGTGTGG + Intergenic
1153918856 18:9770769-9770791 CAAGTTACTCATAGCCTGACAGG - Intronic
1155715289 18:28934837-28934859 CAAGTTACTCCAACTCTATAAGG - Intergenic
925773816 2:7311865-7311887 CAATTTACTCCAAGCCTTAGGGG - Intergenic
926934648 2:18074814-18074836 CAAGTTACTCAAATTCTCTGAGG + Intronic
928676982 2:33660015-33660037 TAATTTGCTTCAAGTCTGAGAGG - Intergenic
929264985 2:39908664-39908686 CAAGTTACCCCAAATCTTAGTGG + Intergenic
929958623 2:46479662-46479684 CTGGTGACTCCAAGTCTGAAGGG + Exonic
930409588 2:51007458-51007480 TAAGTTACTCGAAGTGTTAGGGG + Intronic
931309307 2:61063811-61063833 CCAGCTACTCCAAGGCTGATGGG - Intergenic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
932211743 2:69937219-69937241 CAAGTTTCTGCAAGTCAAAGGGG - Exonic
932270125 2:70401974-70401996 CAAATTACTCCAAAACCGAGTGG + Intergenic
932317762 2:70797441-70797463 CTCTTTCCTCCAAGTCTGAGTGG + Intergenic
936292467 2:111236803-111236825 GCAGTGACTCCAAGTCTGAGGGG - Intergenic
941835436 2:170012690-170012712 CAAGTTACTCAATTTCTCAGGGG - Intronic
942249281 2:174033959-174033981 CGAGTGACTCAGAGTCTGAGTGG + Intergenic
943139175 2:183957643-183957665 CAAACTACTCCAAGTATTAGTGG + Intergenic
944778084 2:202989467-202989489 CAACTGACTACAAATCTGAGAGG + Intronic
945084747 2:206119749-206119771 CAATTTACTACAAATTTGAGGGG + Intronic
1169677423 20:8169702-8169724 CAAGTTCCTGGGAGTCTGAGTGG - Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1175204729 20:57302845-57302867 CTAGGTACTCCAAGTTTGTGGGG - Intergenic
1175459254 20:59138820-59138842 CAAGCCACTCCAAGTCCCAGTGG - Intergenic
1175683858 20:61012060-61012082 CAAGCTACTGAAGGTCTGAGTGG + Intergenic
1178296007 21:31410997-31411019 CAAGTGGCTCCAAGGGTGAGTGG + Intronic
1178588714 21:33891464-33891486 CAATTTACTCATAGTCTGATGGG - Exonic
1184074415 22:42167074-42167096 CAATGTACTCCAAGTCCAAGAGG + Intronic
1184669236 22:46004163-46004185 CAGGGTTCTCCCAGTCTGAGGGG + Intergenic
1185200074 22:49496477-49496499 CAAGTTACTTCACCTCTGAGTGG - Intronic
949308956 3:2674121-2674143 CAAACTACTCCAAAACTGAGCGG - Intronic
954096500 3:48332861-48332883 TAATTTGCTTCAAGTCTGAGAGG + Intergenic
955077426 3:55626797-55626819 GAAGGAACTCCAGGTCTGAGAGG - Intronic
956644690 3:71444328-71444350 AATGTTGCTCCAAGTCAGAGAGG + Intronic
956764372 3:72472103-72472125 CAAATTACTCCAAAACTTAGTGG + Intergenic
956796129 3:72720334-72720356 CAAGTCACTCGACCTCTGAGGGG + Intergenic
957066103 3:75523654-75523676 CATGTCACTCCAAATCTCAGTGG - Intergenic
960402427 3:117218057-117218079 CAGGTTACAGCAAGTCTGTGTGG + Intergenic
960951075 3:122998761-122998783 AAAGATACTCCAAGTCTCATTGG + Intronic
961287046 3:125814403-125814425 CAAGTCACTCCAAATCTCAGTGG + Intergenic
961421403 3:126807793-126807815 CAAATTACTCCAAAACTTAGTGG + Intronic
961734707 3:128994060-128994082 GAAGAGACTCCAAGACTGAGAGG + Exonic
962763916 3:138543475-138543497 CAAGTACTTCCAAGCCTGAGGGG + Intronic
964534411 3:157703724-157703746 CAAATTACTCCAAAACTAAGTGG - Intergenic
964692019 3:159460724-159460746 CAAGTTTGTCCAAGACTAAGGGG - Intronic
965075685 3:163972339-163972361 CAAATTACTCCAAAACTTAGTGG - Intergenic
968079955 3:195839149-195839171 CAAATGACTCCAAAACTGAGTGG + Intergenic
968494571 4:908208-908230 CAAGTTACTCCAAGTGTGCTGGG + Intronic
969010705 4:4059737-4059759 CAAGTCACTCCAAATCTCAGTGG - Intergenic
969743352 4:9050156-9050178 CAAGTCACTACAAATCTCAGTGG + Intergenic
969802745 4:9582255-9582277 CAAGTCACTCCAAATCTCAGTGG + Intergenic
970178294 4:13361686-13361708 CAAATTACTCAAAGACTTAGGGG + Intronic
971704844 4:30027878-30027900 CAAGTTACTTCAACTCTCTGAGG - Intergenic
971925244 4:33001387-33001409 CAAGTTACTCCAAAACTTGGTGG + Intergenic
972082539 4:35171708-35171730 CAAGCAAGTCCAAGACTGAGGGG - Intergenic
977067407 4:92335240-92335262 GAAGTTACTCTCAGCCTGAGTGG + Intronic
989399921 5:40997970-40997992 CAAGATGCTCCAAGTTTGTGAGG + Intergenic
990892184 5:60661542-60661564 TAATTTGCTTCAAGTCTGAGAGG - Intronic
992758416 5:79930661-79930683 CAATTTACAACAACTCTGAGAGG + Intergenic
993167129 5:84371659-84371681 TAGGTTACTCCATATCTGAGGGG + Intronic
994691262 5:103022388-103022410 CAAGTTATTCCAATTCCAAGTGG + Intronic
996369167 5:122735062-122735084 TAAATTACTCCAAAACTGAGTGG + Intergenic
999940970 5:156542654-156542676 CAAATTACTCCATGTCTCTGAGG - Intronic
1001432771 5:171676232-171676254 CAAATTACCCCAAAACTGAGTGG + Intergenic
1003665299 6:8106279-8106301 CAAGATACTCTAAGTTTGATGGG - Intergenic
1003985889 6:11434795-11434817 CAAGTTACTCCAAGGTTGCAAGG - Intergenic
1005041507 6:21604483-21604505 TAAATTATTCAAAGTCTGAGGGG - Intergenic
1007831115 6:44639223-44639245 CAAATTACCCCAAGACTCAGTGG + Intergenic
1009566451 6:65317527-65317549 CAAATTACTCCAACACTTAGTGG + Intronic
1009758545 6:67973836-67973858 GAGGTTACTTCAAGTGTGAGGGG + Intergenic
1009937869 6:70254930-70254952 TAATTTACTCCAAGAGTGAGTGG - Intronic
1012968992 6:105706340-105706362 CAAGTTAATACAAGTCTTAAAGG + Intergenic
1016343314 6:143085137-143085159 TAATTTGCTTCAAGTCTGAGAGG + Intronic
1016618616 6:146081155-146081177 CAACTTGCTCTAAGTATGAGAGG + Intronic
1018498685 6:164378899-164378921 CAAGTTACTCCACATCTGCTAGG + Intergenic
1018772582 6:166984936-166984958 CAAATTACTCCAAAACTTAGTGG + Intergenic
1020341427 7:7115289-7115311 GAAGATACTCCAAGTCAGAATGG - Intergenic
1026901006 7:74037568-74037590 CCAGGGGCTCCAAGTCTGAGCGG + Intronic
1027569942 7:79853302-79853324 GAAGTTAGTCAAAGTCTGAATGG - Intergenic
1029069993 7:97887741-97887763 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1029389370 7:100264847-100264869 CAAATTACCCCAAATCTTAGTGG + Intronic
1031471460 7:122173513-122173535 TAATTTGCTTCAAGTCTGAGAGG - Intergenic
1032725768 7:134588903-134588925 TAATTTGCTTCAAGTCTGAGAGG - Intergenic
1033488655 7:141817917-141817939 CAAGTTACCCCAAAACTCAGAGG - Intergenic
1035299174 7:157886045-157886067 TAAGCAACTCCAAGTCTGATGGG + Intronic
1036159916 8:6377880-6377902 AAAGTTACTTCAAGTCATAGAGG + Intergenic
1036248563 8:7141949-7141971 CAAGTCACTCCAAATCTCAGTGG + Intergenic
1036252249 8:7172395-7172417 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1036365243 8:8115065-8115087 CAAGTCACTCCAAATCTCAGTGG + Intergenic
1036885685 8:12551047-12551069 CAAGTCACTCCAAATCTCAGTGG - Intergenic
1036893305 8:12610119-12610141 AAAGTCACTCCAAATCTCAGTGG - Intergenic
1037697313 8:21235797-21235819 CAAGTCACTCCAAAGCTCAGTGG + Intergenic
1041909546 8:63073720-63073742 CAAGTCACTCCAAGAATTAGTGG - Intronic
1042056045 8:64765844-64765866 TAATTTGCTTCAAGTCTGAGAGG - Intronic
1043157256 8:76799210-76799232 CCAGTCACACCAAGTCTCAGTGG + Intronic
1043491982 8:80758925-80758947 CAAGTTACTCAAATTCTGTAAGG - Intronic
1045388164 8:101690543-101690565 CAACTTACTCCAAACCTGACAGG + Intronic
1046224814 8:111264053-111264075 CAAATTACCCCAAGACTTAGAGG + Intergenic
1048510792 8:135060445-135060467 GCAGTTACTCCAAGGATGAGAGG - Intergenic
1048688323 8:136929430-136929452 GAATTTACTCCAACTCTGATTGG + Intergenic
1053569317 9:39287996-39288018 CACGGGGCTCCAAGTCTGAGTGG + Exonic
1054090949 9:60846980-60847002 CAAGGGGCTCCAAGTCTGAGTGG + Intergenic
1054112360 9:61122536-61122558 CAAGGGGCTCCAAGTCTGAGTGG + Intergenic
1054127825 9:61331014-61331036 CACGGGGCTCCAAGTCTGAGTGG - Intergenic
1055470224 9:76603405-76603427 CAAATTATTCCAAATCTTAGTGG + Intergenic
1055530040 9:77175113-77175135 CCAGCTACTCCAAGGGTGAGAGG - Intergenic
1056594900 9:87999476-87999498 CTAGTTACTCCAAGTATTACTGG + Intergenic
1056778685 9:89533192-89533214 AAAGTCAGTCCAAGTCTGAAGGG - Intergenic
1056974736 9:91241951-91241973 CAAGTTACTCTAAAACTCAGTGG + Intronic
1186996556 X:15129650-15129672 AAAGTAACTCCAGGTGTGAGTGG - Intergenic
1187250833 X:17596710-17596732 CCAGCCACTCCAAGTCTCAGGGG + Intronic
1187565937 X:20449683-20449705 CAAATGACCCAAAGTCTGAGTGG - Intergenic
1188421680 X:29997227-29997249 CAAGTTATCCCAAGACTTAGAGG + Intergenic
1188532943 X:31162825-31162847 AAAGTTAATTGAAGTCTGAGGGG - Intronic
1188800101 X:34518879-34518901 CACATTACCCCAAGTCTTAGTGG + Intergenic
1189571460 X:42302244-42302266 CAAGTTACTCCAAAATTTAGTGG - Intergenic
1190727643 X:53200571-53200593 CAACTTACACCACGACTGAGAGG + Intronic
1191167154 X:57403086-57403108 TAATTTGCTTCAAGTCTGAGAGG + Intronic
1192132903 X:68569487-68569509 AAAGTTACTCCAAAACTCAGTGG - Intergenic
1192297060 X:69861971-69861993 CAAATTACTCCAAAACTTAGTGG + Intronic
1192940032 X:75902440-75902462 TAATTTGCTTCAAGTCTGAGAGG + Intergenic
1195979921 X:110566840-110566862 CAAGTTACCCCAAAACTTAGTGG + Intergenic
1196092448 X:111760354-111760376 GAAGTTACTCCAATTCTGCATGG - Exonic
1196962043 X:121014172-121014194 CAAGTTCCCCCAGGTCTGGGTGG + Intergenic