ID: 912513943

View in Genome Browser
Species Human (GRCh38)
Location 1:110206597-110206619
Sequence GCCTGACATCCCTAAGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912513934_912513943 20 Left 912513934 1:110206554-110206576 CCAGCCCTAGCTCCGTCTCTCAG No data
Right 912513943 1:110206597-110206619 GCCTGACATCCCTAAGCGGGGGG No data
912513935_912513943 16 Left 912513935 1:110206558-110206580 CCCTAGCTCCGTCTCTCAGAGTT No data
Right 912513943 1:110206597-110206619 GCCTGACATCCCTAAGCGGGGGG No data
912513933_912513943 26 Left 912513933 1:110206548-110206570 CCAACACCAGCCCTAGCTCCGTC No data
Right 912513943 1:110206597-110206619 GCCTGACATCCCTAAGCGGGGGG No data
912513937_912513943 8 Left 912513937 1:110206566-110206588 CCGTCTCTCAGAGTTCGCTGCTG No data
Right 912513943 1:110206597-110206619 GCCTGACATCCCTAAGCGGGGGG No data
912513932_912513943 27 Left 912513932 1:110206547-110206569 CCCAACACCAGCCCTAGCTCCGT No data
Right 912513943 1:110206597-110206619 GCCTGACATCCCTAAGCGGGGGG No data
912513936_912513943 15 Left 912513936 1:110206559-110206581 CCTAGCTCCGTCTCTCAGAGTTC No data
Right 912513943 1:110206597-110206619 GCCTGACATCCCTAAGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912513943 Original CRISPR GCCTGACATCCCTAAGCGGG GGG Intergenic
No off target data available for this crispr