ID: 912513951

View in Genome Browser
Species Human (GRCh38)
Location 1:110206648-110206670
Sequence CCTGGAGTCATAGGGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912513951_912513960 11 Left 912513951 1:110206648-110206670 CCCTCCAACCCTATGACTCCAGG No data
Right 912513960 1:110206682-110206704 TGAGGCCCTGAGCCCTGCCCAGG No data
912513951_912513957 -7 Left 912513951 1:110206648-110206670 CCCTCCAACCCTATGACTCCAGG No data
Right 912513957 1:110206664-110206686 CTCCAGGTCCATAGTGTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912513951 Original CRISPR CCTGGAGTCATAGGGTTGGA GGG (reversed) Intergenic