ID: 912513951 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:110206648-110206670 |
Sequence | CCTGGAGTCATAGGGTTGGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912513951_912513960 | 11 | Left | 912513951 | 1:110206648-110206670 | CCCTCCAACCCTATGACTCCAGG | No data | ||
Right | 912513960 | 1:110206682-110206704 | TGAGGCCCTGAGCCCTGCCCAGG | No data | ||||
912513951_912513957 | -7 | Left | 912513951 | 1:110206648-110206670 | CCCTCCAACCCTATGACTCCAGG | No data | ||
Right | 912513957 | 1:110206664-110206686 | CTCCAGGTCCATAGTGTATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912513951 | Original CRISPR | CCTGGAGTCATAGGGTTGGA GGG (reversed) | Intergenic | ||