ID: 912515091

View in Genome Browser
Species Human (GRCh38)
Location 1:110212067-110212089
Sequence GGCCCCCACGAGGGAGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 273}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912515078_912515091 27 Left 912515078 1:110212017-110212039 CCAGCGACGAGGCCGGCGACGAT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 912515091 1:110212067-110212089 GGCCCCCACGAGGGAGGCGCGGG 0: 1
1: 0
2: 0
3: 25
4: 273
912515077_912515091 28 Left 912515077 1:110212016-110212038 CCCAGCGACGAGGCCGGCGACGA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 912515091 1:110212067-110212089 GGCCCCCACGAGGGAGGCGCGGG 0: 1
1: 0
2: 0
3: 25
4: 273
912515081_912515091 15 Left 912515081 1:110212029-110212051 CCGGCGACGATGAGCGGGAGCTG 0: 1
1: 0
2: 1
3: 4
4: 39
Right 912515091 1:110212067-110212089 GGCCCCCACGAGGGAGGCGCGGG 0: 1
1: 0
2: 0
3: 25
4: 273
912515086_912515091 -10 Left 912515086 1:110212054-110212076 CCTGCAGCGACTGGGCCCCCACG 0: 1
1: 0
2: 0
3: 5
4: 170
Right 912515091 1:110212067-110212089 GGCCCCCACGAGGGAGGCGCGGG 0: 1
1: 0
2: 0
3: 25
4: 273
912515085_912515091 -9 Left 912515085 1:110212053-110212075 CCCTGCAGCGACTGGGCCCCCAC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 912515091 1:110212067-110212089 GGCCCCCACGAGGGAGGCGCGGG 0: 1
1: 0
2: 0
3: 25
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912515091 Original CRISPR GGCCCCCACGAGGGAGGCGC GGG Exonic
900014152 1:137329-137351 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
900044015 1:492531-492553 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
900065425 1:727437-727459 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
900185016 1:1328868-1328890 GCCTCCCAGGAGGGAGACGCTGG + Exonic
900209032 1:1444488-1444510 GGCCTTCAGGAGGGAGGGGCAGG - Intergenic
900437833 1:2639926-2639948 GGCCCCCAGGCGGCAGGTGCAGG - Intronic
901626885 1:10629733-10629755 GGCCCCCAGGAGGAAGGCGAGGG + Exonic
902330217 1:15727626-15727648 GGATACCACGAGGGAGGCTCAGG + Exonic
902693750 1:18126673-18126695 GGCTCCCATGAGGGTGGGGCAGG - Intronic
902880860 1:19370956-19370978 GGGCCCCATGAGGGAGGGACTGG + Intronic
903323496 1:22556271-22556293 GCCCTCCACAAGGGAGGCCCTGG - Intergenic
903830130 1:26169720-26169742 GGCCCTCGCTGGGGAGGCGCGGG - Intergenic
903907663 1:26697358-26697380 GGGCCCCAGGACGGGGGCGCCGG + Exonic
904260900 1:29287108-29287130 CGCCCCCAGGAGGGAGTCCCAGG + Intronic
904609809 1:31719386-31719408 GGCTCCCAAGATGGAGGAGCTGG - Intergenic
904829828 1:33299546-33299568 GACCCCCAGGTGGGAGGGGCAGG + Exonic
905308643 1:37034962-37034984 GGCTCCCACGCGGCGGGCGCTGG + Intergenic
905389706 1:37628602-37628624 GGCCCACACGAGGGAGATGGTGG - Intronic
905779090 1:40692040-40692062 GGACCCCACGAGCGCGGCGGCGG - Intronic
905792732 1:40798936-40798958 GACCCCAACAAGGGAGGGGCTGG - Intronic
905792931 1:40799723-40799745 GGCCTCCACGAGGGAGGCCTGGG + Intronic
907306303 1:53514924-53514946 GGCCCCAGTGAGGGAGGTGCTGG + Intronic
912515091 1:110212067-110212089 GGCCCCCACGAGGGAGGCGCGGG + Exonic
914758240 1:150578900-150578922 GGCCACCAGCAGGAAGGCGCTGG - Exonic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
922734047 1:227970214-227970236 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
922734438 1:227971753-227971775 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
922734484 1:227971934-227971956 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
922734726 1:227972885-227972907 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
922734765 1:227973065-227973087 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
924343447 1:243054771-243054793 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
924343479 1:243054904-243054926 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1066733023 10:38450744-38450766 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1066733099 10:38451062-38451084 GGCCCCCATGTGGGAGGCAGAGG + Intergenic
1067300204 10:45001050-45001072 GGCCGCAACGAGGGCGGCGCGGG + Intronic
1069445783 10:68472026-68472048 GGGCCCCACGTGGAACGCGCCGG - Intronic
1069755368 10:70771507-70771529 GGCCCCCACCTGGGAGCTGCAGG + Intronic
1070329968 10:75409620-75409642 GGGCCTCAGGAGGGAGGGGCGGG + Intergenic
1070539643 10:77406867-77406889 GGCCCCCAGGACTGAGGAGCAGG - Intronic
1073425300 10:103452214-103452236 GGCCTCCAGGAGGGCGGTGCAGG + Exonic
1073544651 10:104338097-104338119 AGCCCCCACCCGGGAGGAGCAGG + Intronic
1075759779 10:124847124-124847146 GGGCCCCACGAAGGAGGCTGGGG + Intergenic
1076795531 10:132796255-132796277 GGCGCCCCGGAGGGAGGAGCAGG + Intergenic
1076837890 10:133030236-133030258 GCCCACCACGGGGGAGGCGCCGG + Intergenic
1076970352 11:129006-129028 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1076979671 11:197805-197827 GGCACCCAGCAGGGAGGGGCAGG - Intronic
1077445691 11:2589603-2589625 GGCTCCCACGAGTGAGGCCCTGG + Intronic
1078180135 11:9004238-9004260 GGCCCCCACGCAGGAGGGGGCGG - Intergenic
1078857149 11:15215488-15215510 GGCCCCAATGAGGGAGGCATGGG + Intronic
1081540740 11:44032901-44032923 GGCTCCCCCGAGGGAGACGCGGG + Intergenic
1081938195 11:46918709-46918731 GGGCCCCGCGCAGGAGGCGCCGG - Intergenic
1082260036 11:50071657-50071679 GGCCGCCAGGAGGGAGGCAGAGG + Intergenic
1084192188 11:67504324-67504346 GCCCGCCACGAGGGAGGCAGAGG + Intronic
1084274563 11:68044788-68044810 GGCCCCCACCAGGGCAGAGCAGG + Intronic
1084485062 11:69443393-69443415 GGCCCCCGCAAGGTAGGCGGTGG + Intergenic
1084516156 11:69638984-69639006 GGAACCCGCGGGGGAGGCGCTGG - Intergenic
1084533904 11:69745775-69745797 GGCCCCCACCAGGGAAGCCAGGG + Intergenic
1085384924 11:76152083-76152105 AGCTCCCACGGGGCAGGCGCGGG + Intergenic
1088250642 11:107858546-107858568 GGCCCCCAGCAGGGAGGCAGAGG - Intronic
1088761558 11:112933855-112933877 GGCCCTCAGGAGGGAAGCCCAGG - Intergenic
1089290675 11:117436250-117436272 GGCCCCCAGGAGGGGTGAGCAGG - Intronic
1091259715 11:134224740-134224762 GGACCCCACCCGGCAGGCGCAGG + Exonic
1094484697 12:30915160-30915182 GGACCACAGGAGGGAGGCGGAGG + Intergenic
1096024703 12:48350809-48350831 GGCGCCCGGGAGGGAGGCACCGG - Intronic
1096155072 12:49337110-49337132 CGCCCGCAGGAGAGAGGCGCGGG - Exonic
1096659563 12:53115742-53115764 GGCCCACGAGAGGGAGGCGCTGG + Intronic
1097247367 12:57613902-57613924 GGCTCCCACCAGGGAGGGGGAGG + Intronic
1098320542 12:69239515-69239537 GGCCCGAGGGAGGGAGGCGCGGG - Exonic
1102459660 12:113092881-113092903 CGCCCTCTCGAGGGAGGAGCCGG + Intronic
1102492793 12:113298965-113298987 GGCCCCGCTGAGGGAGGCACAGG + Exonic
1103488311 12:121297129-121297151 GGCCCGCCCGAGGGCGCCGCGGG - Intronic
1104373931 12:128247555-128247577 GGCACCCATCAGGGAGGCTCGGG - Intergenic
1104987114 12:132603497-132603519 GACCCCCACGAGGCTGGTGCCGG - Intronic
1105011722 12:132761263-132761285 GGCCCAAAGGAGGGCGGCGCGGG - Intronic
1106584315 13:31044013-31044035 GGCCCCCACGTGGTGGGAGCGGG + Intergenic
1106675346 13:31952680-31952702 GGCCTCCTGGAGGGAGGCGCCGG - Intergenic
1107549150 13:41458479-41458501 GGCCCCCGCTAGGATGGCGCCGG + Intronic
1108046270 13:46387304-46387326 GGCCCCCGTGTGGGAGGCGGGGG - Exonic
1108686777 13:52826562-52826584 GGCGCCCATCAGGGAGGCTCAGG - Intergenic
1111842867 13:93472602-93472624 GGCCCCAAAGAGGGAGTCACAGG + Intronic
1113483759 13:110640124-110640146 AGCCACCACGGGAGAGGCGCTGG - Intergenic
1113554876 13:111224978-111225000 GGGCCCCCCGAGGCAGGCGTAGG + Intronic
1113893537 13:113749020-113749042 GGCGCCCACGGGGCAGGCTCCGG + Intergenic
1117744934 14:58860182-58860204 GGCCCCCAGGAGGAATGCTCAGG + Intergenic
1118314247 14:64716044-64716066 GGGCACCACGAGGGTGGCGAGGG - Intronic
1122399245 14:101457725-101457747 GGAGCCCGGGAGGGAGGCGCGGG + Intergenic
1122793336 14:104193572-104193594 GGCCCCCAGGAGGGGTGCACAGG - Intergenic
1123029073 14:105442339-105442361 TTCCAACACGAGGGAGGCGCAGG + Intronic
1123118152 14:105904037-105904059 GGGCACCAGGAGGGAGGGGCTGG - Intergenic
1130547884 15:84869657-84869679 GGCCTCCAGGAGGGATGCTCTGG - Exonic
1131215086 15:90529854-90529876 GGCCCCGCCGAGGGTGGGGCGGG + Intergenic
1132523044 16:400233-400255 GGCCCCCTCCACGGAGTCGCTGG - Exonic
1132547777 16:541145-541167 GGCCCCCAGGTGGGAGGGACGGG + Intronic
1132642697 16:984974-984996 GGCCCACACGGGGGACGCCCCGG - Exonic
1132747622 16:1443508-1443530 GGCCCCCGAAAAGGAGGCGCCGG - Exonic
1132981667 16:2741376-2741398 GGGCCCCTCGAGGGAAGCTCTGG + Intergenic
1133170095 16:3977523-3977545 GGCCCCCACGACGGTGGCGAGGG + Exonic
1133271225 16:4611733-4611755 GGAGCCCCAGAGGGAGGCGCTGG + Intronic
1135325582 16:21523499-21523521 GGTCCCCAGGAGGCGGGCGCAGG - Intergenic
1136080857 16:27851873-27851895 CCCCACCTCGAGGGAGGCGCAGG - Intronic
1137557935 16:49484522-49484544 GGCCCCCAGGTGGGTGGGGCCGG + Intergenic
1140471716 16:75219030-75219052 GGCCCCCACAAGGGAGAAGCAGG - Exonic
1141615323 16:85206763-85206785 GGCCGCCAGGATGGAGGTGCTGG + Intergenic
1142038581 16:87878077-87878099 GGTCCCCAGGAGGCAGGCACAGG - Intergenic
1142262768 16:89050482-89050504 GGCCCCCACGATGGAGACTGGGG - Intergenic
1142417839 16:89952735-89952757 GGACCCCAACAGGGAGGCACGGG - Intronic
1142457187 17:63370-63392 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1142598308 17:1040189-1040211 GGCCCCCAGGACGCACGCGCAGG + Intronic
1145050254 17:19654366-19654388 GGCGCCCATCAGGGAGGCTCGGG + Intronic
1147690631 17:42312628-42312650 GGGCCCCAAGAGGGAGGTGCAGG + Intergenic
1148800261 17:50220842-50220864 GGGCCCTAGGAGGGAGGGGCAGG - Intergenic
1150624807 17:66835061-66835083 GGACCCCGAGAGGGAGGGGCGGG - Intergenic
1151181317 17:72330865-72330887 TGCACCCAAGAGGCAGGCGCTGG + Intergenic
1151552821 17:74831817-74831839 AGCCTCCACGAGGTGGGCGCAGG + Intronic
1151954524 17:77373724-77373746 GTCCCCCACGTAGGCGGCGCGGG - Intronic
1152128009 17:78459066-78459088 GGCGCCCAAGAGGCAGGCACTGG - Exonic
1152363343 17:79842323-79842345 GGCCCCTCCCAGGGAGCCGCAGG + Intergenic
1155426919 18:25716487-25716509 GGACCCCCCGAGCCAGGCGCGGG - Intergenic
1157422398 18:47557915-47557937 TGCACCCCCGAGGGAGGCCCAGG + Intergenic
1157532172 18:48430256-48430278 GGCCACCAGGAGGGCGGCACAGG + Intergenic
1160647546 19:200475-200497 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1160753767 19:747468-747490 TGCCCCCACCCGGGAGGGGCCGG + Exonic
1160765801 19:807119-807141 GGCCCCCGCGAGGGAGGGCCAGG - Intronic
1160834181 19:1116872-1116894 GGCGCGCACGCGGGAGGTGCTGG - Exonic
1160853475 19:1205832-1205854 GGCGCCCGCGAGTGAGGCGCGGG + Intronic
1160859271 19:1230845-1230867 GGGCCCCCCGAGGATGGCGCTGG - Exonic
1160967906 19:1754551-1754573 GGGCCGCACGGGGGAGGCGGCGG + Exonic
1161041465 19:2112898-2112920 GGACGCCAAGACGGAGGCGCAGG - Exonic
1161045050 19:2130228-2130250 GGCAGCCAGGAGGGAGGTGCTGG - Intronic
1161157431 19:2739934-2739956 GGCCCCCGGGAGGTAGGTGCGGG - Exonic
1161175809 19:2841672-2841694 GGCCCCGGCGAGGGCGGCGCAGG + Intronic
1161296389 19:3522674-3522696 AGGCCCCAGGAGGGAGGCGGGGG - Intronic
1161510020 19:4665069-4665091 GGCCACCAGGAGGGCGGGGCAGG - Intronic
1161587423 19:5113215-5113237 AGCCCCCAGGATGGCGGCGCGGG - Intronic
1161925263 19:7294533-7294555 GGGCCCCGCGCGGGAGGCCCTGG + Intergenic
1162091044 19:8280413-8280435 GGCGCTCATGAGGGAGGCTCGGG + Intronic
1162093278 19:8295251-8295273 GGCGCTCATGAGGGAGGCTCGGG + Intronic
1162421646 19:10568905-10568927 GGCCCCCAAGGGGCGGGCGCCGG - Exonic
1162520319 19:11175792-11175814 GGTCCCCACTAGGCAGGAGCAGG + Intronic
1163299475 19:16434711-16434733 GGTCCTCAGGAGGGAGGCCCTGG + Intronic
1164708587 19:30338727-30338749 GGACCCCACCAAGGAGGGGCTGG + Intronic
1164834877 19:31350195-31350217 GGCCCCCTCCAGGGAGGAGGCGG + Intergenic
1165173114 19:33906936-33906958 GGCCCCCAACAGGGCGGAGCTGG - Intergenic
1165902357 19:39174731-39174753 CGCCCCCAGAAGGGAGGCGTGGG + Intronic
1166506202 19:43373161-43373183 GGCCCCAAGGATGAAGGCGCTGG - Intergenic
1167217081 19:48171793-48171815 GGCCCCCAGGATGGAGCGGCCGG + Exonic
1167264881 19:48478548-48478570 GGCCCCCACGCAGGAGGAGAAGG + Exonic
1167399362 19:49254814-49254836 GGACCCCTGGAGGGAGACGCCGG + Intergenic
1168097403 19:54123565-54123587 GTCCGCTTCGAGGGAGGCGCCGG + Intronic
1168335212 19:55593402-55593424 GGCCCCGAGGGGGCAGGCGCGGG - Exonic
925419953 2:3703721-3703743 GGCCCCGGCGAGCGAGGAGCGGG + Exonic
926914292 2:17878327-17878349 GGCGCGCAGGTGGGAGGCGCGGG + Intronic
927481322 2:23456559-23456581 AGCACCCACGAGTGAGGAGCCGG + Intronic
927492765 2:23531447-23531469 GAGCCCCACGAGGGAGGCGGAGG - Intronic
928412894 2:31067958-31067980 GGCCCACACGAAGGAAGAGCAGG - Intronic
928429558 2:31206198-31206220 GGCCTCCACGTGGGAGCTGCTGG - Intronic
929681309 2:43995857-43995879 GGCCGCCAGGGAGGAGGCGCAGG + Exonic
930641738 2:53860068-53860090 GGGCCCCAGGAGGCAGGCGACGG - Intergenic
932406074 2:71513322-71513344 GGCCCCCACGGGTGAGACACGGG + Exonic
932555929 2:72825265-72825287 GGCTCCCAGGAGAGGGGCGCGGG + Intronic
938087015 2:128408415-128408437 GGGCCCCACGTGGGAGACACAGG + Intergenic
941819078 2:169827311-169827333 GGCGCCCAGGAGAGAGGGGCGGG + Intergenic
942346272 2:175005506-175005528 GGCCGCCTCCAGGGGGGCGCTGG - Intergenic
942501145 2:176592178-176592200 GGCCCCCACCATGGTGGGGCTGG + Intergenic
947670046 2:231930124-231930146 GGTCCCCAGGAGGGAGGAACAGG + Intergenic
948492538 2:238322273-238322295 GAGCCCCAGGAGGGAGGTGCAGG + Intronic
1171011487 20:21511769-21511791 CGGCTCCACTAGGGAGGCGCCGG - Exonic
1173849815 20:46210613-46210635 GGCCTTCACGAGGGAGGCCAAGG + Intronic
1175132956 20:56803204-56803226 GGCCCAGACGAGGCAGGTGCGGG - Intergenic
1175433148 20:58921486-58921508 TGCCCCCACGAGGAAGGCCCTGG + Intergenic
1175915808 20:62425224-62425246 GTCCCACATGAGGGAGGCGCAGG - Intronic
1175977123 20:62716675-62716697 GGCCCACAGGAGGGAGGACCTGG - Intronic
1176083802 20:63286784-63286806 TGCCCCCACGTAGGAGGAGCTGG + Intronic
1176550042 21:8217066-8217088 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
1176568969 21:8400101-8400123 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
1176576883 21:8444336-8444358 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
1179783997 21:43719502-43719524 GGCGCCCTGGAGGCAGGCGCGGG + Intronic
1180063859 21:45403272-45403294 GGCTCCCAGGAGGGAGGGGCTGG - Intergenic
1181527965 22:23500942-23500964 AGCCCCCACCAGGGAGCCCCAGG - Intergenic
1182048756 22:27297488-27297510 GGCCCCCATGAGGGTGGGGTAGG + Intergenic
1182146253 22:27998592-27998614 GGCCTCCCCCAGGGCGGCGCTGG + Exonic
1182417923 22:30233119-30233141 GGAACCCCCGAGGGAGGCACTGG - Intergenic
1182853629 22:33498246-33498268 GGCCCCCACGGTGGAGGGGAGGG + Intronic
1183247312 22:36703594-36703616 GCCCGCCAGGAGGGGGGCGCTGG + Intergenic
1183380990 22:37490471-37490493 GCCCCCCAAGAGGGAGGCATAGG + Exonic
1183858548 22:40652786-40652808 GGCCCCCACCTGGGAGGTGTGGG + Intergenic
1184093817 22:42305881-42305903 GCCCCTCAGGAGGGAGGCACTGG + Intronic
1184866228 22:47203115-47203137 GGCCCCCACGCTGGAGGCTGTGG - Intergenic
1185313909 22:50170651-50170673 GGGCCCGGCGAGGGGGGCGCGGG - Intergenic
1185336331 22:50272264-50272286 GCCCCCCTGGAGGGAGCCGCCGG + Intergenic
1203254932 22_KI270733v1_random:133392-133414 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
1203262988 22_KI270733v1_random:178471-178493 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
953152143 3:40334250-40334272 GTCCCCCAGGAGGGAGCCCCAGG + Intergenic
954004380 3:47579381-47579403 GGTCTCCACGAGGGAGGGGCGGG + Exonic
954392619 3:50275479-50275501 GGCCGCCGGGAGGGAGGCGAAGG + Intronic
954458241 3:50611581-50611603 GGCCACCACGAGGGGCGCACGGG - Intronic
954892583 3:53944707-53944729 GGCTCCCAGGAGGGTGGGGCAGG + Intergenic
968370295 3:198219637-198219659 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
968501418 4:951911-951933 GGCCCCGATGAGGGAGTCACCGG + Intronic
969323536 4:6427391-6427413 GGCCCCCACGTGGGAGCCTCTGG - Intronic
969690348 4:8700832-8700854 TGCCCCCACCAGGGAGGGGGTGG - Intergenic
972197647 4:36673712-36673734 GGCACCAACCAGGGAGGCGGAGG - Intergenic
973142129 4:46781967-46781989 GGCGCCCATCAGGGAGGCTCGGG - Intronic
975345937 4:73292889-73292911 GGCCCCTCCGAGCCAGGCGCGGG + Intergenic
976629380 4:87220712-87220734 GCCGCCCACTAGGGAGCCGCGGG - Intronic
984429237 4:179626915-179626937 GGCCGCCACAAGGGAGCTGCAGG - Intergenic
985696760 5:1345189-1345211 GCACCCCAGGAGGGCGGCGCGGG - Intergenic
986297183 5:6449186-6449208 GGCCTCCACGGTGTAGGCGCTGG - Exonic
986438139 5:7755330-7755352 TGCCCCCCTGAGGGAGACGCAGG - Intronic
986919070 5:12662211-12662233 GGCGCCCATCAGGGAGGCTCAGG - Intergenic
988466937 5:31500216-31500238 GGCCCCAACTGGGGAGGTGCTGG + Intronic
992124289 5:73625783-73625805 GCGCCTCCCGAGGGAGGCGCTGG - Intergenic
992895811 5:81244282-81244304 GGCCCACACCAGGAAGGGGCAGG - Intronic
1001027125 5:168233627-168233649 GGCCACCACAAGGGAGAAGCTGG + Intronic
1001960693 5:175878890-175878912 GGCCCCTACGAGGAAGGGGTGGG - Exonic
1002729828 5:181326398-181326420 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1002991868 6:2245732-2245754 GGCCACCGCGCGGGAGGGGCGGG + Intergenic
1003426068 6:5999276-5999298 GGCCGCCAGCGGGGAGGCGCAGG - Intronic
1006300806 6:33192744-33192766 GGCCCCCAAGAGGGAGGGAATGG - Intergenic
1007760029 6:44128009-44128031 GGCACCCCCGAGGGTCGCGCAGG - Intronic
1011470371 6:87701971-87701993 GGCTCCCCCGAGAGAGGCTCCGG + Exonic
1012399960 6:98834914-98834936 GGCGTGCACGATGGAGGCGCTGG - Exonic
1014088334 6:117373343-117373365 GGCACCCATCAGGGAGGCTCGGG + Intronic
1018872650 6:167795463-167795485 GGAGCCCACGAGGGGGACGCGGG - Intronic
1019256661 7:56808-56830 GGCCCCCAAGAGGGTTCCGCTGG + Intergenic
1019343476 7:519108-519130 GGCCCGGAGGAGGGTGGCGCGGG + Exonic
1019361216 7:605048-605070 GGGTCCTACGAGGGAGGCGTGGG + Intronic
1019611229 7:1937621-1937643 CGCCCCCAGCAGGGAGGTGCAGG + Intronic
1019614588 7:1953389-1953411 GGCCCCCGCCAGGGAGGAGCAGG + Intronic
1023401054 7:39793182-39793204 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1023401086 7:39793314-39793336 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1023856378 7:44186715-44186737 GGTCCCCAAGAGGGATGCCCAGG + Intronic
1023874795 7:44281122-44281144 AGCAACCACGCGGGAGGCGCTGG + Intronic
1024074123 7:45810160-45810182 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1024075069 7:45813974-45813996 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1024648525 7:51387367-51387389 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1024648581 7:51387597-51387619 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1024649209 7:51390038-51390060 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1025052302 7:55741516-55741538 GGCCGCCATGAGGGAGGCAGAGG - Intergenic
1025052766 7:55743383-55743405 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025052912 7:55743877-55743899 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1025053289 7:55745368-55745390 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1025129335 7:56367518-56367540 GGCCCCCGTGAGGGAGGAGCAGG - Intergenic
1025130280 7:56371300-56371322 GGCCGCCATGAGGGAGGCAGAGG - Intergenic
1025130355 7:56371619-56371641 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025130443 7:56371979-56372001 GGCCACCGTGAGGGAGGCACTGG + Intergenic
1025130600 7:56372598-56372620 GGCCGCCATGAGGGAGGCAGAGG - Intergenic
1025130675 7:56372917-56372939 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025130761 7:56373273-56373295 GGCCCCCGTGAGGGAGGAACTGG + Intergenic
1025130918 7:56373892-56373914 GGCCGCCATGAGGGAGGCAGAGG - Intergenic
1025130990 7:56374210-56374232 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025176440 7:56804583-56804605 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1025690241 7:63750267-63750289 GGCCACCATGACGGAGGAGCTGG - Intergenic
1025690689 7:63752090-63752112 GGCCACCATGACGGAGGAGCTGG - Intergenic
1025912778 7:65841176-65841198 GGCCACCAGGAGGCAGGAGCTGG - Intergenic
1026858437 7:73769792-73769814 GGCCACCACGATGAGGGCGCGGG + Exonic
1026953807 7:74364408-74364430 GGCCCCCCCGGGGAAGGGGCTGG + Intronic
1027956111 7:84880950-84880972 GACCCCCGCGAGGGATGCACTGG + Intergenic
1028918830 7:96288624-96288646 GGACCCTCCGAGCGAGGCGCAGG - Intronic
1029443874 7:100602470-100602492 GGGCCCCAGGAGGGAGGCTGTGG - Exonic
1032051590 7:128653696-128653718 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1033299927 7:140176651-140176673 GCCCGGCCCGAGGGAGGCGCGGG + Intronic
1034481341 7:151322186-151322208 GGCCCCAAAGAGGGAGTCACAGG - Intergenic
1034911790 7:155003331-155003353 GGCCCCGCCGAGGGGGGAGCTGG - Intergenic
1035169680 7:157010520-157010542 GGCCCGCACGGAGGAGGCGCCGG - Exonic
1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG + Intronic
1036773706 8:11595627-11595649 GGACCCCAAGAGGCAGGAGCTGG + Intergenic
1037862009 8:22412073-22412095 GGCCCCCAGGAGGGAGCAGAGGG - Intronic
1039936447 8:42051169-42051191 GGCCGGCTCGAGGGCGGCGCGGG + Intronic
1041673746 8:60517351-60517373 CGCGGCCAGGAGGGAGGCGCCGG - Intronic
1043472593 8:80578043-80578065 GGCCCCCGGAGGGGAGGCGCCGG - Intergenic
1043611583 8:82069665-82069687 GGCCCCCACGTGTGTAGCGCTGG - Intergenic
1045248008 8:100460138-100460160 GTCCCCAACAAGGCAGGCGCGGG - Intergenic
1048009425 8:130443854-130443876 GGCAGCCACGAGGGGGGCGTGGG + Intergenic
1049159101 8:141086132-141086154 GGTCCCCACGAGGGAGGGTGGGG + Intergenic
1049386785 8:142346933-142346955 GACCCCCACGAGGTGGGCGAGGG + Intronic
1049759712 8:144326506-144326528 GGCCCCGACGTGGGAGCCGCGGG - Exonic
1049801086 8:144517834-144517856 GGCCCCCGCGACGGCTGCGCGGG - Intronic
1052014884 9:23452304-23452326 GGAGCCCACCAGGGAGGCTCAGG - Intergenic
1053413477 9:37930553-37930575 GGCCCCCACCAGGGTGGGCCAGG - Intronic
1056960397 9:91117717-91117739 GGAGCCCACGAGGGTGGGGCCGG - Intergenic
1057436404 9:95044819-95044841 GGCCTGCACTAGAGAGGCGCTGG + Intronic
1057478718 9:95427021-95427043 GGCCGGCACGAGGCAGCCGCGGG + Intergenic
1060280666 9:122213707-122213729 GGCGCCCCCGAGGGCGGCACTGG + Exonic
1061425686 9:130496905-130496927 AGCCTCCAGGAGGGAGGGGCTGG - Intronic
1061670808 9:132187153-132187175 GGCCCCCCTGGGGGAGGAGCAGG + Intronic
1062033361 9:134371988-134372010 GCACCCCACAAGGGAGGCCCAGG - Intronic
1062754240 9:138278910-138278932 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1203471334 Un_GL000220v1:116538-116560 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
1203479155 Un_GL000220v1:160510-160532 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
1203577800 Un_KI270745v1:21667-21689 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1187067505 X:15854865-15854887 GGGCCGGACGAGGGAGGAGCCGG + Exonic
1187367699 X:18677965-18677987 GGCACCCAGGAGGGAGAGGCCGG + Intronic
1189491309 X:41473509-41473531 GGCCCCCACGGCCCAGGCGCTGG - Exonic
1192657089 X:73003384-73003406 GGCCACCCCGGGGGAGGCGGAGG + Intergenic
1192665031 X:73079617-73079639 GGCCACCCCGGGGGAGGCGGAGG - Intergenic
1201260920 Y:12158496-12158518 GGCACCCATCAGGGAGGCTCAGG + Intergenic
1202380874 Y:24276056-24276078 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1202489910 Y:25394069-25394091 GGCCACCGTGAGGGAGGAGCAGG - Intergenic