ID: 912515102

View in Genome Browser
Species Human (GRCh38)
Location 1:110212088-110212110
Sequence GGCCATGGCGCCGGGTCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 294}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912515095_912515102 -7 Left 912515095 1:110212072-110212094 CCACGAGGGAGGCGCGGGCCATG 0: 1
1: 0
2: 1
3: 14
4: 165
Right 912515102 1:110212088-110212110 GGCCATGGCGCCGGGTCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 294
912515094_912515102 -6 Left 912515094 1:110212071-110212093 CCCACGAGGGAGGCGCGGGCCAT 0: 1
1: 0
2: 1
3: 4
4: 61
Right 912515102 1:110212088-110212110 GGCCATGGCGCCGGGTCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 294
912515093_912515102 -5 Left 912515093 1:110212070-110212092 CCCCACGAGGGAGGCGCGGGCCA 0: 1
1: 0
2: 1
3: 5
4: 87
Right 912515102 1:110212088-110212110 GGCCATGGCGCCGGGTCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 294
912515092_912515102 -4 Left 912515092 1:110212069-110212091 CCCCCACGAGGGAGGCGCGGGCC 0: 1
1: 0
2: 1
3: 15
4: 161
Right 912515102 1:110212088-110212110 GGCCATGGCGCCGGGTCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 294
912515086_912515102 11 Left 912515086 1:110212054-110212076 CCTGCAGCGACTGGGCCCCCACG 0: 1
1: 0
2: 0
3: 5
4: 170
Right 912515102 1:110212088-110212110 GGCCATGGCGCCGGGTCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 294
912515085_912515102 12 Left 912515085 1:110212053-110212075 CCCTGCAGCGACTGGGCCCCCAC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 912515102 1:110212088-110212110 GGCCATGGCGCCGGGTCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912515102 Original CRISPR GGCCATGGCGCCGGGTCTGG GGG Exonic
900203107 1:1420072-1420094 GGCCACAGCGCTGGGTCTGGCGG - Exonic
900269067 1:1778070-1778092 GGCCTTGGGGACGGGTCTGAGGG - Intronic
900314007 1:2048175-2048197 GGCCATGGGGCCTGGAGTGGGGG + Intergenic
900425885 1:2578426-2578448 GGCCATGTGGGCGGGTGTGGGGG - Intergenic
900587308 1:3439549-3439571 GCCCATGGCCTGGGGTCTGGGGG + Intergenic
900981483 1:6048540-6048562 AGCCAAGGCCCCGGGGCTGGAGG - Intronic
901505022 1:9679351-9679373 AGCCACCGCGCCTGGTCTGGGGG + Intronic
901753534 1:11427034-11427056 GGCCATGGCACCAGGAATGGGGG - Intergenic
902865118 1:19273038-19273060 GGCAATGCCGCCGGTGCTGGGGG - Intergenic
903177075 1:21587594-21587616 GGGCCTGGGGCAGGGTCTGGAGG + Intergenic
903703491 1:25267940-25267962 GGGCGGGGCGCCGGGTCCGGAGG - Intronic
903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG + Exonic
903712758 1:25338269-25338291 GGGCGGGGCGCCGGGTCCGGAGG - Exonic
903718768 1:25389014-25389036 TGCCATGGTGCTGGGTCTTGTGG - Exonic
903724701 1:25431501-25431523 GGCCATGCCGCTGGGCCGGGAGG + Intronic
904379457 1:30101260-30101282 GGGCATGGCTCCGGGACAGGGGG + Intergenic
904703136 1:32370514-32370536 AGCCATGTCGCCGGGCGTGGTGG + Intronic
907322562 1:53614489-53614511 GGCCACAGAGCAGGGTCTGGGGG + Intronic
912515102 1:110212088-110212110 GGCCATGGCGCCGGGTCTGGGGG + Exonic
915288764 1:154869256-154869278 GGTGATGGAGCAGGGTCTGGTGG + Exonic
915356883 1:155260619-155260641 GGCAATGGGGCAGGGGCTGGAGG + Exonic
915937617 1:160098502-160098524 GGGGATGGCGCGGGTTCTGGGGG + Exonic
916715124 1:167441441-167441463 GGCCATGGAGCTGGGACTAGGGG - Intronic
917304935 1:173615143-173615165 AGCCACCGCGCCCGGTCTGGGGG - Intronic
919630892 1:199959550-199959572 GGCCTTGGCGCCCACTCTGGCGG + Intergenic
919738129 1:200966293-200966315 GGCAATGGGGTCGGGACTGGTGG - Intergenic
921039123 1:211413085-211413107 AGCCATGGCACCTGGCCTGGAGG - Intergenic
921112103 1:212048476-212048498 GGCCATTTGGCCGGGTGTGGTGG - Intronic
924604075 1:245517076-245517098 GGGGATGGGGCCGGGTGTGGTGG + Intronic
1063427285 10:5960210-5960232 GGCCAGGACGCCGTGGCTGGTGG + Intronic
1063754708 10:8994610-8994632 TACCATGGGGCCGGGTGTGGTGG + Intergenic
1064417671 10:15164750-15164772 GGCCATGGTGCCCGGCCTGGAGG - Intronic
1065538337 10:26736243-26736265 AGCCATGTGGCAGGGTCTGGAGG - Intronic
1067236924 10:44458917-44458939 GGCCATGGTTGCGGGTCTGTGGG + Intergenic
1067769832 10:49115347-49115369 GGCCGGGGCTCCGGGCCTGGTGG - Intronic
1068007549 10:51408719-51408741 GGCCATGGTGGCGGGGATGGAGG - Intronic
1068783282 10:60944151-60944173 GGCCACGGCGCCGGGCGAGGCGG - Exonic
1069695519 10:70382677-70382699 GGTCCTGGCGCCGGGATTGGCGG - Intergenic
1069832287 10:71288790-71288812 AGGCATGGGGCCGGGTTTGGGGG - Intronic
1071503311 10:86218560-86218582 GGATATAGCGCAGGGTCTGGAGG + Intronic
1074618365 10:115093098-115093120 GACCAAGGCGCCGGGCCTGTGGG + Intergenic
1074853934 10:117459611-117459633 GGCCAGGCGGCCGGGCCTGGTGG + Intergenic
1075197688 10:120375266-120375288 GGCCATGCCCCAGGGGCTGGGGG + Intergenic
1075719510 10:124576589-124576611 GACCATGGAGGAGGGTCTGGGGG - Intronic
1076711579 10:132338634-132338656 AGCCATGGCGCCGGGGATGTGGG - Intronic
1077262418 11:1629886-1629908 GGCCGTGGCTCCGGCTGTGGGGG + Exonic
1077334220 11:1996357-1996379 GGCCAAGACGCCAGGTCCGGTGG - Intergenic
1079106068 11:17573232-17573254 GCCCATGGCGCCGGCACAGGTGG - Exonic
1081110645 11:39129572-39129594 GGCCATGGCGGCAGGGATGGAGG + Intergenic
1081609182 11:44548715-44548737 GGCCATGGTGGCAGGGCTGGAGG + Intergenic
1082987603 11:59181959-59181981 GGCGTTGGCGCTGGGTCTGACGG - Exonic
1083688322 11:64391053-64391075 GGACTTGGGGCCGGGTGTGGTGG + Intergenic
1083691298 11:64410432-64410454 GGCCATGGGGCCGGGGTCGGGGG + Intergenic
1083941928 11:65900501-65900523 GGCCAAGGCGGCGCGTCTCGGGG - Exonic
1084284123 11:68120805-68120827 GTCGGTGGCGCCGGGTCTGGGGG - Intronic
1084484272 11:69438888-69438910 GGCGCTGGCGGTGGGTCTGGGGG - Intergenic
1084626328 11:70310669-70310691 GTACATGGGGCCGGGTGTGGTGG - Intronic
1084700714 11:70784812-70784834 GGCCCTGGCCCCGGGGCTGAAGG - Intronic
1084824993 11:71723305-71723327 GGCCAAGGCCCTGGGGCTGGAGG - Intergenic
1088039502 11:105360942-105360964 GGCTATGGAGCTTGGTCTGGAGG + Intergenic
1202817203 11_KI270721v1_random:51539-51561 GGCCAAGACGCCAGGTCCGGTGG - Intergenic
1092063219 12:5567404-5567426 TGCCATGGCGTCCTGTCTGGGGG - Intronic
1093524845 12:20093747-20093769 GGCCTTGGCGCCCACTCTGGTGG - Intergenic
1094066175 12:26363007-26363029 GTCCATGGCCCAGGGTTTGGGGG - Intronic
1094131826 12:27082862-27082884 GGGAATGGGGCCGGGTGTGGTGG - Intergenic
1094833424 12:34311201-34311223 GGGCATGGCGCAGGGGCTGCTGG + Intergenic
1096288892 12:50324087-50324109 GGCCATGGTGGCAGGACTGGAGG + Intergenic
1098515916 12:71376734-71376756 GGCCTTGGCGCCCATTCTGGCGG + Intronic
1101965628 12:109280053-109280075 GGGCATGGGGCCGGGCCTGGTGG + Intronic
1103359652 12:120346231-120346253 GGCCATGGGGCCGGGGCTGGTGG + Exonic
1103882905 12:124180149-124180171 GGCCATGGCGCCCGGACTACAGG + Intronic
1107951420 13:45465326-45465348 GGCCATGGTGGCGGATCCGGTGG + Intronic
1107952732 13:45478774-45478796 GGCCATTTCACCGGGTGTGGTGG - Intronic
1108038027 13:46312396-46312418 AGCCATGGCGCCTGGCCTGGAGG - Intergenic
1108358792 13:49651166-49651188 AGCCAGGGGGCCGGGTATGGTGG + Intergenic
1109387298 13:61647591-61647613 GGCTATGAGGCTGGGTCTGGTGG - Intergenic
1113071377 13:106424689-106424711 GGCTTTGGGGCCGGGTGTGGTGG + Intergenic
1114532982 14:23406993-23407015 GGGCATGGCGCCGGGGCAGAAGG - Intronic
1115565365 14:34620651-34620673 GGACATGGGGCCGGGCATGGTGG + Intronic
1115757646 14:36545047-36545069 TGCCATTGGGCCGGGTGTGGTGG - Intergenic
1117315157 14:54566190-54566212 GGCCATGCCGTCGGGGCGGGCGG - Intergenic
1121662940 14:95649511-95649533 GGGCATGGAGCCTGGTTTGGAGG + Intergenic
1122880361 14:104688076-104688098 GGCCCTGGAGCCCGGTGTGGAGG + Intergenic
1124139435 15:27064332-27064354 GGCCTTACCGCCGGGCCTGGAGG - Intronic
1124590780 15:31051213-31051235 GGCCTTGTCTCCTGGTCTGGTGG + Intronic
1125688526 15:41578298-41578320 GGCCATTTGGCCGGCTCTGGTGG + Exonic
1125835774 15:42749455-42749477 TGCCATGGGGCCGGGAATGGGGG - Intronic
1128128877 15:65212292-65212314 GGCCAGGGGGCCGGGAGTGGGGG - Intergenic
1129761417 15:78131268-78131290 GGCGCTGGCTCCGGGTCTGGCGG - Exonic
1130518683 15:84645686-84645708 AGCCCTGGCCCTGGGTCTGGTGG - Exonic
1130631084 15:85569788-85569810 GGCCACTGGGCCGGGTGTGGTGG + Intronic
1133333284 16:4989632-4989654 GGCAATGGAGCCGGGTACGGTGG - Intronic
1134330662 16:13248306-13248328 AGCCATGGTGCCGGGCCTTGAGG + Intergenic
1136228440 16:28873689-28873711 GCCCAGGGCGCTGGGTCTGGTGG + Exonic
1136234637 16:28905977-28905999 GGCCCTGGGCCCGGGGCTGGGGG + Intronic
1137687000 16:50393239-50393261 GCCCATGGGGCAGGGTATGGGGG - Intergenic
1137701642 16:50502068-50502090 TGGCATGGAGCAGGGTCTGGAGG - Intergenic
1139300804 16:65943690-65943712 GGGCATGGAGCTGGGGCTGGAGG - Intergenic
1139549627 16:67666384-67666406 GGACAGAGCGTCGGGTCTGGGGG + Exonic
1139724983 16:68890593-68890615 GGGCATGTGGCCGGGTGTGGTGG + Intronic
1141689245 16:85587177-85587199 GACCATGGGGTCTGGTCTGGGGG - Intergenic
1141989746 16:87602975-87602997 GGCCGCGGCGCCGGCTCCGGAGG - Exonic
1142596165 17:1031122-1031144 GGAGATGCTGCCGGGTCTGGGGG - Intronic
1143087162 17:4424719-4424741 AGCCACGGCGCCTGGCCTGGAGG + Intergenic
1144719843 17:17461637-17461659 GGCCATAGAGCCAGGTGTGGTGG + Intergenic
1144777865 17:17793824-17793846 GGGCATGGTGCCGGCTCTGAAGG - Exonic
1145013193 17:19381512-19381534 GGGCATGGTGGCGGGGCTGGTGG - Exonic
1145784941 17:27587651-27587673 GGCAATGGCGCTGAGTATGGGGG + Intronic
1145827338 17:27886931-27886953 TGGCATGGGGCCGGGTGTGGTGG - Intronic
1146646676 17:34581073-34581095 GGCCATGGCCCCGGGGATGTCGG + Exonic
1146887676 17:36483346-36483368 GGCCATTAGGACGGGTCTGGAGG + Intergenic
1146957024 17:36941960-36941982 GGACAGGCCGCCGTGTCTGGAGG - Intronic
1147659778 17:42111371-42111393 GGTCATGGCACCGGGCCAGGTGG + Exonic
1148936350 17:51166780-51166802 GGCCCGGGCGCAGGCTCTGGCGG - Exonic
1149481792 17:57009421-57009443 GGCCATGGCGGCGGGGATGGAGG + Intergenic
1149655960 17:58309716-58309738 GGCCAGGGCGCTGTATCTGGTGG + Intronic
1149684341 17:58526842-58526864 GGCCTTGGCTCCGGGACTTGGGG + Exonic
1151490670 17:74431006-74431028 GGGCAGGGCGCCGAGTCTCGGGG - Exonic
1151816816 17:76475188-76475210 GGCCCTGTGGCCGGGACTGGGGG - Intronic
1152093436 17:78259026-78259048 GGACAGGGCGCTGGGCCTGGGGG + Intergenic
1152790031 17:82273784-82273806 GGGCACGGCGCAGGGTCGGGAGG - Intergenic
1154012682 18:10589220-10589242 GGCGATGGCCCCGGGCCAGGAGG + Intergenic
1158460800 18:57644097-57644119 GGCCTTGGCGCCTACTCTGGCGG - Intergenic
1160556561 18:79729387-79729409 GGACATGGGACGGGGTCTGGAGG + Intronic
1160729066 19:632519-632541 GGCCTTGGCGGCGGGGCCGGGGG + Intronic
1161273894 19:3404835-3404857 GGCCTGGGCAGCGGGTCTGGAGG - Intronic
1161600047 19:5176415-5176437 GGCAATTGGGCCGGGTGTGGTGG + Intronic
1162056264 19:8065946-8065968 GGCCATGGGGCCAGGCCTTGAGG - Exonic
1162411760 19:10510443-10510465 GGCCCTGGGGCCGGGTTGGGGGG - Intergenic
1162779753 19:13000865-13000887 GGCCGTGGCGCCGTGGCTGTGGG + Intronic
1162812527 19:13172824-13172846 GGCCCTGGCGCCGGCTCGGCGGG + Intergenic
1163541263 19:17912170-17912192 GGGCATGGGGCTGGGTGTGGTGG - Intergenic
1163546465 19:17943816-17943838 GGCCAAGGCGCCGGGCCCCGGGG + Exonic
1164926587 19:32135360-32135382 GTCCATGGCCCCGGGGCTTGGGG + Intergenic
1164989602 19:32674750-32674772 GGCCGGGGTGCCGGGTCCGGCGG - Intronic
1165263694 19:34642426-34642448 GGCAAAGGGGCCGGGCCTGGTGG + Intronic
1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG + Intronic
1165986263 19:39771506-39771528 GTCCATGGGGCTGGGTATGGTGG - Intergenic
1166045297 19:40226443-40226465 GGCGAGGCCGCCGGGGCTGGAGG - Exonic
1166299315 19:41905117-41905139 GGCCCTGGCATAGGGTCTGGGGG + Intronic
1166998794 19:46732826-46732848 GGCCATGGCGAAGTGTGTGGAGG + Intronic
1167258473 19:48444258-48444280 GGCCACGGCCCCGGGCGTGGAGG - Exonic
1167328551 19:48839809-48839831 GTCTAAGGGGCCGGGTCTGGTGG + Intronic
1168297393 19:55384118-55384140 GGCCGTGGCGCTGGATGTGGCGG - Exonic
927056865 2:19373517-19373539 GGCCATGGGGGCGGGGCTGCTGG - Intergenic
932606171 2:73167089-73167111 AGCCATGGTGCCGGGTCAGCTGG + Intergenic
933926257 2:87093362-87093384 AGCCATGGTGCCGGGTCAGCTGG - Intergenic
934855283 2:97725444-97725466 GGCCAAGGGACCGAGTCTGGAGG - Intronic
934859850 2:97755557-97755579 GGCTATGGCACAGGGGCTGGGGG - Intergenic
935374251 2:102379154-102379176 GACCCTGGGGCCGGGTGTGGTGG + Intronic
935424990 2:102910492-102910514 GGCCATGGTGCCAGGGATGGAGG - Intergenic
935592381 2:104855107-104855129 GCCCAGCGCGCCGGGGCTGGGGG + Intergenic
938119524 2:128623823-128623845 GGCCATGGTGATGGGTCTGAGGG + Intergenic
942349399 2:175037465-175037487 TGACATGGGGCCGGGTGTGGTGG + Intergenic
944522454 2:200586178-200586200 GGCCCTGGCCGCAGGTCTGGGGG - Intronic
946693972 2:222333618-222333640 GGGGATGGAGCCGGGTCAGGTGG - Intergenic
948216467 2:236237036-236237058 CGCCCGGGCGCGGGGTCTGGGGG - Intronic
948636435 2:239340790-239340812 GGCCAGGGTGCCTGGCCTGGAGG - Intronic
948825925 2:240573437-240573459 GGCCAGGCTGCCGGGTCTGAGGG - Intronic
948930361 2:241127990-241128012 GGCCAGGGGGCCGGGCGTGGTGG + Intronic
949027339 2:241772758-241772780 GGCCAACGCGCCGGGCCAGGTGG - Intergenic
1171123054 20:22582208-22582230 GGAGAGGGCGCCGGCTCTGGGGG + Exonic
1172777424 20:37415595-37415617 GGCCCTGGTCCCTGGTCTGGTGG + Intergenic
1173246397 20:41340695-41340717 GGACTTGGGGCGGGGTCTGGTGG + Intergenic
1174222882 20:48971614-48971636 AGCCATGGCGCCCAGGCTGGGGG - Intronic
1174374479 20:50116610-50116632 GGCCATGGCGACTGGAATGGCGG - Intronic
1174779677 20:53377570-53377592 GGCCACTGGGCCGGGTATGGTGG + Intronic
1175358099 20:58384998-58385020 GGCCATGGTGGCAGGTGTGGAGG + Intergenic
1175938290 20:62525264-62525286 GGCCATGGCGGGGGGAGTGGGGG + Intergenic
1176121770 20:63457324-63457346 GGCCATGGGGCAGGGACGGGAGG + Intronic
1176140403 20:63542411-63542433 GGCCGTGGCGCAGGATCTCGGGG + Intronic
1176289558 21:5036912-5036934 GGACATGGGGCCAGGTCTGGAGG + Intronic
1178596497 21:33958088-33958110 GTCCATGGCCCAGGGACTGGGGG + Intergenic
1178960476 21:37060156-37060178 GGCCATGTCTCCAGGTCTGCAGG + Intronic
1179094388 21:38299332-38299354 GGACATGACGCGGGGTCTGTTGG - Exonic
1179149261 21:38796070-38796092 GACCATGGGGCTGGCTCTGGGGG + Intergenic
1179298938 21:40089501-40089523 GGCCATGGCACTGGTCCTGGGGG - Intronic
1179397672 21:41056324-41056346 GGCCTCTGCGCCCGGTCTGGTGG - Intergenic
1179867672 21:44226675-44226697 GGACATGGGGCCAGGTCTGGAGG - Intronic
1179887146 21:44319023-44319045 GGCGAGGGGGCCGGGTGTGGGGG + Intronic
1179902934 21:44403146-44403168 GCCCATGGGGCTGGGGCTGGGGG - Intronic
1180006106 21:45021431-45021453 GGCCACGGCCCTGGGGCTGGTGG + Intergenic
1180086395 21:45509704-45509726 GGCCATGGGTGGGGGTCTGGCGG + Intronic
1180179137 21:46110155-46110177 TGCCATGGGGCCGGGCCGGGTGG - Intronic
1180701018 22:17781482-17781504 GGCCACAGCACCGGGGCTGGTGG + Intergenic
1181519476 22:23436940-23436962 GGCCATGGCACCGGGTGGGCAGG + Intergenic
1182115699 22:27755095-27755117 GGCCATGTCACCAGCTCTGGTGG + Intronic
1183483691 22:38078192-38078214 GGCGATGGGGCAGGGCCTGGCGG + Exonic
1183514364 22:38255309-38255331 GGCCATGAGGCCGGGTGCGGTGG - Intronic
1183658414 22:39204381-39204403 GGCCATGGCTGCGGGGATGGTGG - Intergenic
1183736322 22:39646796-39646818 GGGCCTGGCGCCGGCTCTGCAGG - Exonic
1185213297 22:49584202-49584224 GGGCCTGGAGCCGGCTCTGGAGG + Intronic
1185271013 22:49929364-49929386 GGCCCTGCCGCAGGGTCTTGCGG - Intergenic
1185338906 22:50282995-50283017 GGCCCTGGCCCTGGGTATGGAGG - Intronic
950172863 3:10851604-10851626 GGCCTTGGAGCAGGGCCTGGAGG - Intronic
950934578 3:16825556-16825578 AGCCATGGAGCCGGGGATGGAGG + Intronic
951154079 3:19327575-19327597 GGCCATGGGGCCAGGCATGGTGG - Intronic
952776714 3:37053520-37053542 GGCCTTGGCACGGGTTCTGGAGG - Exonic
952963006 3:38604499-38604521 GGCACTGGAGCCGGGGCTGGGGG - Intronic
953422969 3:42769590-42769612 GGCCTTGGCGCCCACTCTGGCGG + Intronic
954104981 3:48405106-48405128 GGCCATGGCACGGGGCTTGGGGG - Intronic
954401359 3:50321379-50321401 GGCCCTGGCGCCGGTCCCGGTGG - Exonic
954468980 3:50675320-50675342 GGCCGTGGCGGGGGTTCTGGGGG + Intronic
960087818 3:113609351-113609373 GCTCATGGGGCCGGGTGTGGTGG - Intronic
964115216 3:153129608-153129630 CGCCGTGGCGCCGGGGCGGGAGG + Intergenic
965371059 3:167863221-167863243 GGCCATGAGGCCGGGCGTGGTGG - Intergenic
965429490 3:168568741-168568763 GGCCAGGGGGCCAGGTGTGGTGG - Intergenic
967207729 3:187139177-187139199 GGCCCTGGCGGCGGGTGAGGAGG + Intronic
967950180 3:194834574-194834596 GAGCATGGGGCCGGGTATGGTGG + Intergenic
968441783 4:627975-627997 GGCCATGGCACTGGGGGTGGGGG - Intronic
969702308 4:8774251-8774273 GGCCATCGCCCCTGGTCTGGGGG - Intergenic
969746966 4:9080156-9080178 GGCCAAGGCTCTGGGGCTGGAGG - Intergenic
970361925 4:15318563-15318585 GGGCATGGTGCCGGGCATGGTGG - Intergenic
977701631 4:100029052-100029074 GGCCATGGTGGCAGGTGTGGAGG - Intergenic
979931948 4:126642207-126642229 GCCCATGGCCCCTGGACTGGAGG + Intergenic
981491578 4:145346195-145346217 GGCGAAGGCGCCGGGGCTGGCGG + Intergenic
983511270 4:168611872-168611894 AGCCATGGCGCCTGGCCTGTTGG - Intronic
983826794 4:172272240-172272262 GGCCATGGGGCCGGGTGCAGTGG - Intronic
985678171 5:1242960-1242982 GGCCCTGGCCCTGGGTCTGTGGG - Intronic
985692251 5:1319827-1319849 GGCCCTGGGGCCGGCACTGGAGG + Intronic
985722578 5:1497526-1497548 GGCCCTGGGGCCACGTCTGGCGG + Intronic
985899841 5:2779934-2779956 GGCCATGGCCCCAGCTGTGGAGG + Intergenic
986261514 5:6151690-6151712 GGCCATGGTGGCAGGTTTGGAGG - Intergenic
986297202 5:6449252-6449274 GGCGAGCGCGCCGGGGCTGGGGG + Intronic
986690692 5:10311362-10311384 AGCCATGGCACCTGGCCTGGGGG - Intergenic
990128362 5:52548043-52548065 GGCCATGGCTCCAGGTTTGATGG - Intergenic
992224444 5:74606396-74606418 AGTCATGGGGCCGGGTGTGGTGG + Intergenic
992952750 5:81876738-81876760 GGCCAGAGGGCCGGGTGTGGTGG - Intergenic
997302242 5:132814213-132814235 GGCCCGGGCTCCGCGTCTGGCGG - Exonic
998423777 5:142010444-142010466 GGCCACAGGGCCGGGTGTGGTGG - Intronic
999245929 5:150154773-150154795 GGTCATGCTGCTGGGTCTGGGGG - Intronic
1000279947 5:159773623-159773645 GACCGTGGCGCGGGGTCGGGCGG + Intergenic
1002076546 5:176711926-176711948 GGGGATGGCCCCGGGTCTGGGGG + Intergenic
1002579770 5:180200830-180200852 GGCCCTGGAGCCGGTTCTGAAGG - Intronic
1003524701 6:6888049-6888071 CGCCTTGGGGCCGGGTGTGGTGG + Intergenic
1004259689 6:14097251-14097273 GGCCATGGGGCCTGGCCTAGGGG - Intergenic
1004647874 6:17580609-17580631 GGCCTTGGCGCCCGCTCTCGCGG + Intergenic
1005826976 6:29638460-29638482 TGCCTTGGAGCCGGGTGTGGTGG - Intergenic
1005832391 6:29681139-29681161 GGCCGCGGCGCCGGGACTGCGGG - Intergenic
1006304086 6:33208518-33208540 GGCCATGGCGGCGGCGGTGGCGG + Exonic
1007474094 6:42107463-42107485 GGCCCTGGGGCTGGGCCTGGGGG + Exonic
1007607556 6:43127640-43127662 GGACATGGGGCCGGGTGCGGTGG + Intronic
1007768886 6:44177772-44177794 GGCCAGGCAGCCGGGTGTGGTGG - Intronic
1008013424 6:46491584-46491606 GGGGAGGGCGCCGGGTCAGGAGG - Intronic
1009420598 6:63460243-63460265 GGGAATGGGGCCGGGTGTGGTGG - Intergenic
1011293979 6:85807581-85807603 GAACATGGGGCCGGGTGTGGTGG - Intergenic
1011416265 6:87122814-87122836 GGCCCTGGCGGAGGGACTGGCGG - Intergenic
1013182682 6:107731570-107731592 GGCCAGGGCTCCCAGTCTGGAGG - Intronic
1018424252 6:163666055-163666077 GACCATGGGGCGGGGCCTGGAGG - Intergenic
1019281034 7:200323-200345 GCCCATGGCCCCAGGGCTGGGGG + Intronic
1019563987 7:1670710-1670732 GGGCAGGGGGCCGCGTCTGGGGG - Intergenic
1019591802 7:1839392-1839414 GGCCATGGCACCGGGTGGGCAGG - Intronic
1019659741 7:2217484-2217506 GGCCAGAGCACAGGGTCTGGAGG + Intronic
1019716917 7:2543394-2543416 TGCCATGGCTCCGGCACTGGAGG + Intronic
1019972178 7:4549992-4550014 GGCCATGGCAGCTTGTCTGGAGG + Intergenic
1020091730 7:5345697-5345719 GGCCCTGTCACCGGGCCTGGAGG - Exonic
1021729437 7:23582183-23582205 GGCCTTGGAGCCAGGTGTGGTGG + Intergenic
1021942273 7:25689533-25689555 GGCCATGGGGCCTGGGCAGGAGG + Intergenic
1022728638 7:33002896-33002918 GGCCGTGGGGCCGGTTCTGAAGG + Intronic
1024030450 7:45455911-45455933 GGCCGTGGGGCTGGCTCTGGTGG + Intergenic
1025057264 7:55775212-55775234 GGCCATGGGGTGGGGTCGGGTGG + Intergenic
1026006805 7:66606435-66606457 GGCCAAATCGCCGGGTGTGGTGG - Intergenic
1026840432 7:73667775-73667797 AGCCGCGGCGCCGGGGCTGGGGG - Intergenic
1026890374 7:73978367-73978389 CGCCGTGCCGCCGGGTCGGGGGG + Intergenic
1027401623 7:77814749-77814771 AGCCACCGCGCCCGGTCTGGGGG + Intronic
1027421197 7:78019623-78019645 GGCCAGGGCGCCCGGGCTCGCGG - Exonic
1027887220 7:83924462-83924484 AGCCATCGCGCCTGGCCTGGGGG - Intergenic
1029340540 7:99940299-99940321 GGCTATGGAGCCAGGTGTGGTGG - Intergenic
1029481119 7:100813601-100813623 GGGCTTGGGGCCGGGTGTGGTGG - Intronic
1029711182 7:102300835-102300857 GGCCATGGAGCCGGAGCTCGCGG + Exonic
1032525683 7:132577044-132577066 TGCCCTGGGGCCGGGGCTGGGGG + Exonic
1032580446 7:133098803-133098825 GGCCCTGGGGCCAGGTGTGGTGG - Intergenic
1034158624 7:148976041-148976063 GGCCCTGCAGCTGGGTCTGGAGG + Intergenic
1034313823 7:150111881-150111903 GGCCAGCGCGCCGGGAGTGGTGG - Intergenic
1034412307 7:150947831-150947853 GGCCTTGGGGCCGGGCCGGGCGG - Exonic
1034623148 7:152471808-152471830 GTCCTTGGGGCCGGGTGTGGTGG + Intergenic
1034793075 7:153988911-153988933 GGCCAGCGCGCCGGGAGTGGTGG + Intronic
1037239574 8:16760988-16761010 GGCCTTGGCGCCCACTCTGGCGG - Intergenic
1037969353 8:23161005-23161027 GGCCAGGGAGCCTGGTATGGAGG + Intronic
1038883616 8:31640110-31640132 GGCCCTGGCGCCGGGGGCGGCGG + Intronic
1046604687 8:116358040-116358062 GGCCATGGAGAGGGGGCTGGAGG + Intergenic
1048489067 8:134875240-134875262 GGTCATGGCAACGGTTCTGGGGG - Intergenic
1049109856 8:140635801-140635823 GGCGGCGGCGCCGGGTCTGGCGG + Intergenic
1049671700 8:143872941-143872963 GGCCCTGCAGCAGGGTCTGGTGG - Exonic
1049748145 8:144271669-144271691 GGCCCTGGCGCCGGGGCCAGAGG + Intronic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1049852188 8:144838653-144838675 GGCCGTGGAGCCGGGCATGGTGG + Intronic
1051898437 9:22012563-22012585 GGCCATGGGGCCTGGGCAGGAGG - Intronic
1053796406 9:41730831-41730853 GGAAATGGGGCCGGGTATGGTGG - Intergenic
1060207564 9:121691202-121691224 TGCCATGGCCCCTGCTCTGGAGG + Intronic
1060321486 9:122565441-122565463 GGCCATGGCGGCAGGGATGGAGG + Intergenic
1060347535 9:122829656-122829678 GGACATGGGGCCGGGTGCGGTGG + Intergenic
1060736611 9:126070247-126070269 GCCCATGGCGCCAGGCCTGGGGG + Intergenic
1061152222 9:128835437-128835459 GGGCAGGGCGCAGGGGCTGGAGG - Intronic
1061388108 9:130302329-130302351 AGCCATCGCGCCTGGACTGGTGG + Intronic
1061901564 9:133675054-133675076 GGCAAAGGGGCCGGGTGTGGTGG + Intronic
1062254378 9:135614223-135614245 GGCCATGGCTCCGGGGAAGGGGG - Intergenic
1062587732 9:137257030-137257052 CGCCCTGGCGCCTGGTCTTGGGG - Exonic
1185469453 X:373836-373858 GCGCATGGCGCCGGGGGTGGGGG + Intronic
1186856783 X:13634709-13634731 GACAATGGGGCCGGGTATGGTGG + Intergenic
1187385272 X:18842843-18842865 GTCCATGGGGCCGGGCGTGGTGG - Intergenic
1191249582 X:58254015-58254037 GGGCATGGCACAGGGTCTGCTGG + Intergenic
1191251481 X:58262127-58262149 GGACATGGCGCAGGGGCTGCTGG - Intergenic
1191258667 X:58291002-58291024 GGTCCTGGCGCAGGGTCTGCTGG - Intergenic
1192138870 X:68630849-68630871 TTCCAGGGCGCCAGGTCTGGTGG - Intergenic
1192229157 X:69252857-69252879 GGCCATGCCACTGGGTCTTGAGG - Intergenic
1194849129 X:98851335-98851357 GGCCATGGTGGCAGGGCTGGAGG - Intergenic
1197791274 X:130256426-130256448 GGCCATGGGGCCGGGCGCGGTGG + Intronic
1198682186 X:139194844-139194866 GGCCAGGGCTCCGTGGCTGGCGG - Intronic
1200074379 X:153543926-153543948 GGCCAGTGCGCGGGGTGTGGGGG + Intronic
1200340363 X:155389810-155389832 GGCCATGGTGCCAGGGATGGAGG - Intergenic