ID: 912516302

View in Genome Browser
Species Human (GRCh38)
Location 1:110218619-110218641
Sequence CAAGTACAAGACACCGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912516302_912516309 29 Left 912516302 1:110218619-110218641 CCAAACACGGTGTCTTGTACTTG 0: 1
1: 0
2: 0
3: 12
4: 205
Right 912516309 1:110218671-110218693 GAAGACCTTAAGGCTTGGAGAGG No data
912516302_912516308 24 Left 912516302 1:110218619-110218641 CCAAACACGGTGTCTTGTACTTG 0: 1
1: 0
2: 0
3: 12
4: 205
Right 912516308 1:110218666-110218688 TAAATGAAGACCTTAAGGCTTGG No data
912516302_912516307 19 Left 912516302 1:110218619-110218641 CCAAACACGGTGTCTTGTACTTG 0: 1
1: 0
2: 0
3: 12
4: 205
Right 912516307 1:110218661-110218683 CTTTATAAATGAAGACCTTAAGG 0: 1
1: 1
2: 2
3: 50
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912516302 Original CRISPR CAAGTACAAGACACCGTGTT TGG (reversed) Intronic
906762710 1:48391085-48391107 CAAGTATCAGGCACCGTGTCCGG - Intronic
907124957 1:52041517-52041539 CAGGTACAAGACATGGTTTTAGG - Exonic
908332351 1:63083205-63083227 CAAGAGCAAGACAGGGTGTTGGG - Intergenic
909544195 1:76826098-76826120 AATGTACAAGACACAGAGTTAGG + Intergenic
909593788 1:77381479-77381501 CATGTACAAGACACCATGCTTGG + Intronic
911419902 1:97627573-97627595 AAAGAACAAGACACTGTATTAGG + Intronic
912516302 1:110218619-110218641 CAAGTACAAGACACCGTGTTTGG - Intronic
913121169 1:115742252-115742274 CAAGCATGAGACACCGTGTCTGG + Intronic
915439056 1:155933110-155933132 CAAGGACAAGACAAGGTATTTGG + Intronic
915493388 1:156264419-156264441 CATGTGCCAGACACTGTGTTAGG + Intronic
915964830 1:160297445-160297467 CAAGTAAGAGACACCAAGTTAGG + Intronic
918730758 1:187992966-187992988 TATGTCCAAGACACCATGTTAGG - Intergenic
919624791 1:199900637-199900659 CAAGAACAAAACACCGTCTCAGG + Intergenic
921575890 1:216834256-216834278 CAGGTGCAAGACACTGTATTTGG - Intronic
921945598 1:220884043-220884065 CAAGGACCAGACACTGTGGTAGG - Intronic
922470795 1:225875921-225875943 CAAGCACATGCCACCGTGTCTGG - Intronic
922643268 1:227258030-227258052 CAGGCACAAGCCACCGTGTCTGG - Intronic
923482240 1:234396500-234396522 CTACTACCAGACACTGTGTTAGG + Intronic
923654609 1:235904831-235904853 CAAGTGCCAGACACCATGTTGGG + Intergenic
924155608 1:241173505-241173527 CAGGTATGAGCCACCGTGTTTGG - Intronic
924587228 1:245370865-245370887 CAAGTACCAGGCACTGTGCTAGG + Intronic
1065136449 10:22675441-22675463 CAGGCACACGACACCATGTTCGG - Intronic
1065261101 10:23924199-23924221 CATGTGCAAGCCACTGTGTTTGG + Intronic
1065939020 10:30546944-30546966 CAGGTACAAGCCACCATGCTCGG - Intergenic
1066182826 10:32980230-32980252 TAAGCACTAGACACCGTTTTAGG - Intronic
1066574094 10:36806561-36806583 CAAGTATGAGCCACCGCGTTTGG + Intergenic
1066584419 10:36916755-36916777 CATGTGCAAGACACTGTGCTAGG + Intergenic
1070870586 10:79748200-79748222 CATGTACCAGACACTGTGTTAGG - Intergenic
1071637504 10:87270412-87270434 CATGTACCAGACACTGTGTTAGG - Intergenic
1071657741 10:87467539-87467561 CATGTACCAGACACTGTGTTAGG + Intergenic
1076091881 10:127693605-127693627 CAAGCACAAGCCACCGTGCCTGG - Intergenic
1078223125 11:9368181-9368203 TGAGTACCAGACACCGTGCTAGG + Intergenic
1078228361 11:9414899-9414921 CAGGTACGAGCCACCGTGCTTGG + Intronic
1078590410 11:12636317-12636339 CAAGTACACGCCACCGTGACTGG - Intergenic
1082957514 11:58885935-58885957 CAGGTAGAAGACACCATGCTTGG - Intronic
1088060506 11:105643859-105643881 CAGGCACAAGTCACCGTGTCTGG + Intronic
1088615060 11:111618029-111618051 CAAGTGCATGACAGTGTGTTTGG + Intronic
1089425938 11:118374963-118374985 CCAGGACAAGATACAGTGTTTGG - Exonic
1090267965 11:125365913-125365935 CATGTACCAGGCACCGTGCTGGG - Intronic
1093053908 12:14535355-14535377 CAAGTACAAGACTCTTTGCTAGG - Intronic
1094240931 12:28223988-28224010 CAAGTAAAAGACTCCGCTTTAGG - Intronic
1104393719 12:128413518-128413540 CAAGTATAACACACAATGTTGGG - Intronic
1106812049 13:33368373-33368395 TATGTACCAGACACTGTGTTGGG + Intergenic
1106882973 13:34151939-34151961 CATGTACCAGGCACTGTGTTGGG + Intergenic
1108042739 13:46354571-46354593 CAAGTAAAAGAAACCCTGTGTGG - Intronic
1108136998 13:47375399-47375421 CAAGTGCAAGCCACCATGCTGGG - Intergenic
1111528185 13:89501316-89501338 CAGGTACATGTCACCATGTTTGG + Intergenic
1114071394 14:19111232-19111254 CAGGTACATGCCACCATGTTCGG - Intergenic
1115100943 14:29698846-29698868 GAAGTAAAAGAAACTGTGTTGGG + Intronic
1115572020 14:34675692-34675714 CAGGCACAAGACACCATGCTTGG - Intergenic
1115647596 14:35380297-35380319 CAAGAACAAGACTCTGTCTTGGG + Intergenic
1117164326 14:53018475-53018497 CAGGTATAAGCCACCGTGCTTGG + Intergenic
1119335794 14:73832541-73832563 CAGGTATAAGCCACCATGTTTGG + Intergenic
1119494977 14:75070362-75070384 TATGCACAAGACACTGTGTTAGG - Intronic
1119626519 14:76181620-76181642 CAAGTCCCAGATACTGTGTTAGG - Intronic
1122312939 14:100808676-100808698 ACAGTACAAGACCCCGTCTTGGG - Intergenic
1125174410 15:36804464-36804486 CATGTACCAGGCACTGTGTTAGG + Intronic
1126372142 15:47958838-47958860 TATGTACAAGACACAGTGCTAGG + Intergenic
1129076836 15:73004300-73004322 CAAACACATGGCACCGTGTTTGG - Intergenic
1130571300 15:85046528-85046550 CATGTACTAGACACTGTTTTGGG + Intronic
1131807913 15:96142246-96142268 CAGGCACAAGCCACCGTGTCTGG - Intergenic
1133514063 16:6490433-6490455 CGAATACAAGCCACCGTGGTGGG + Intronic
1134162364 16:11901951-11901973 CAGGCACAAGACACCGTGCCCGG - Intronic
1134502229 16:14778215-14778237 CAAGTACATGACACTGCGTCTGG - Intronic
1134578332 16:15350682-15350704 CAAGTACATGACACTGCGTCTGG + Intergenic
1134724258 16:16406867-16406889 CAAGTACATGACACTGCGTCTGG - Intergenic
1134943172 16:18304993-18305015 CAAGTACATGACACTGCGTCTGG + Intergenic
1137447131 16:48538758-48538780 CAAGTGCAAGGCACTGTGCTAGG + Exonic
1138184831 16:54968484-54968506 CATGTGCCAGGCACCGTGTTAGG - Intergenic
1138773986 16:59698279-59698301 GATGTGCAAGACACAGTGTTAGG - Intergenic
1140798020 16:78458536-78458558 CAGGTACAAGCCACCATGTCAGG + Intronic
1141532227 16:84654368-84654390 CAGGTATAAGCCACCGTGCTAGG - Intronic
1141953385 16:87353639-87353661 CAGGTTCAAGACACGGTGTCCGG - Intronic
1143998899 17:11034212-11034234 CAAGTGTAAGATACCGTGCTGGG - Intergenic
1146980249 17:37154027-37154049 CAGGTGCAAGCCACTGTGTTTGG - Intronic
1148045899 17:44744132-44744154 CAAGTATAAGCCACTGTGTCTGG - Intronic
1148055173 17:44789946-44789968 CAAGTATGAGCCACCGTGCTTGG + Intergenic
1148318981 17:46733130-46733152 CAAGTAAAAGAGACGGCGTTAGG - Intronic
1148464836 17:47858551-47858573 TAAGTACCAGACACCATTTTAGG - Intergenic
1149935107 17:60797171-60797193 CAAGCATAAGCCACCGTGCTTGG + Intronic
1150146781 17:62775547-62775569 TGTGTACAAGACACCGTGTTGGG - Intronic
1150447626 17:65239532-65239554 GAATTACAATACACTGTGTTAGG + Intergenic
1155646600 18:28085779-28085801 CTAGTGCAAAACACTGTGTTTGG + Intronic
1157375263 18:47158292-47158314 CAAGTACAAGCCACTGCATTCGG + Intronic
1157812049 18:50704230-50704252 CAGGCATAAGACACCGTGTCTGG - Intronic
1158887903 18:61846207-61846229 CAAGAACAAGAGAGAGTGTTTGG - Intronic
1162081301 19:8219385-8219407 CAGGTGCAAGCCACCGTGTCCGG - Intronic
1163947486 19:20552867-20552889 CAGGGGCAAGTCACCGTGTTTGG - Intronic
1164822177 19:31258643-31258665 CACGGACAAGGCACTGTGTTAGG - Intergenic
1165008438 19:32824952-32824974 CAAGAACAAGACACCGCTTCTGG - Intronic
1166814921 19:45538440-45538462 CAAGTGTAAGACACCGTGCCTGG - Intronic
926476734 2:13331679-13331701 CAAGTAAACGACACTGAGTTTGG - Intergenic
927312834 2:21649893-21649915 CAAACACAAGACACGGTCTTTGG + Intergenic
927909598 2:26887477-26887499 CAATTCCAAAACACAGTGTTGGG + Intronic
928076524 2:28270077-28270099 CAAGTACCTGATACAGTGTTTGG - Intronic
929595405 2:43172414-43172436 CAAGTACCAGCCACCATGTCCGG + Intergenic
929864105 2:45703393-45703415 CAAGTACATGCCACCATGTCTGG - Intronic
935255224 2:101304252-101304274 CAAGTGCACGCCACCGTGTCTGG - Intronic
935493509 2:103749420-103749442 CAAGTACACGTCACTGTATTAGG - Intergenic
938736041 2:134187483-134187505 GAAGTAAAAGACAACGTGTGTGG - Intronic
938886338 2:135653076-135653098 CAAGTGTAAGCCACCATGTTTGG - Intronic
938892633 2:135721204-135721226 CAGGTACAAGCCACCATGCTTGG - Intronic
939863721 2:147449377-147449399 TAGCTACAAGGCACCGTGTTTGG - Intergenic
939949483 2:148452216-148452238 CAAGTGCGAGCCACCGTGCTTGG - Intronic
941491639 2:166149410-166149432 CAAGTGCAAGACACCTCTTTTGG + Intergenic
942038334 2:172033307-172033329 CAAGTACAATAGACCTTATTTGG + Intronic
943841128 2:192582098-192582120 CATGCTCAAGACACTGTGTTTGG - Intergenic
944908891 2:204290014-204290036 TAAGTGCCAGACACTGTGTTAGG + Intergenic
945567878 2:211425959-211425981 CAAGCACGAGACACCGTGCGGGG + Intronic
946596476 2:221310911-221310933 ATAGTACAAGGCACCCTGTTGGG - Intergenic
1169467345 20:5853115-5853137 CATGTGCCAGACACTGTGTTAGG + Intronic
1169513655 20:6293273-6293295 TATGTACTAGACACCGTTTTAGG + Intergenic
1169539120 20:6580820-6580842 CAAGTACAAGGAACAATGTTTGG - Intergenic
1171840500 20:30204550-30204572 CAGGTACAAGCCACCGTGCAGGG - Intergenic
1171994127 20:31719228-31719250 TAAGTACTAGGCACTGTGTTAGG - Intronic
1172275861 20:33678811-33678833 CAAGTACATGCCACCATGTCTGG - Intronic
1173146787 20:40531750-40531772 AAAGTACAAGACACCATGCATGG + Intergenic
1174660748 20:52210819-52210841 CAGGTACAAGCCACCGTGCCCGG - Intergenic
1180729579 22:17971586-17971608 CAGGCACCAGACACTGTGTTGGG + Intronic
1180754795 22:18153565-18153587 CAAGTACATGCCACCATGCTAGG + Intronic
1183562081 22:38583112-38583134 CGAGTACAAGGCACCATGTGGGG - Intronic
950069232 3:10138809-10138831 CAGGCACAAGCCACCGTGCTTGG + Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
955047704 3:55375549-55375571 CAGGTACAAGACACTGTGCCTGG - Intergenic
955773332 3:62407874-62407896 CAGGTACAAGCCACCATGTCCGG + Intronic
956675974 3:71732102-71732124 CATGTGCCAGACACCGTGCTAGG - Intronic
958819539 3:98956927-98956949 CAGGTGCAAGCCACCATGTTTGG - Intergenic
959965237 3:112346654-112346676 CAGGTAGAAGACACTGGGTTGGG - Intronic
960843160 3:121980645-121980667 CAAGCACATGCCACCGTGATTGG + Intergenic
960915863 3:122694204-122694226 CAAGACCAAGCCACCTTGTTTGG - Intronic
962863549 3:139426820-139426842 CTAGTAAAAGACACTGTGCTTGG - Intergenic
966121340 3:176524382-176524404 CAAATACCAGACAGCGTGATGGG - Intergenic
968379315 4:76031-76053 CAAGTACATGCCACCATGTCCGG + Intronic
972404109 4:38730498-38730520 CAGGTACACGCCACCGTGCTTGG + Intergenic
977281561 4:95046188-95046210 CAAGTACAAACCACTGTGTCCGG + Intronic
977402392 4:96548600-96548622 CAAATATGAGACACCCTGTTGGG + Intergenic
979394467 4:120169539-120169561 GTAGTACAAGGCACTGTGTTAGG - Intergenic
979636689 4:122963205-122963227 TAAGTACAATACAGTGTGTTGGG + Intronic
986729376 5:10623895-10623917 AAAATACAATACACAGTGTTTGG + Intronic
986909742 5:12540605-12540627 CAGGTACAACATACAGTGTTTGG + Intergenic
988397443 5:30712724-30712746 CAAGTAGAAGCCACCGTGCCTGG + Intergenic
990553428 5:56907510-56907532 GAAGTACAAGGTACGGTGTTTGG + Intergenic
990723378 5:58724487-58724509 CAAGTACAAGCCACTGTGGGGGG - Intronic
991125628 5:63066641-63066663 CAAGTACAAGGCACTGTTCTAGG - Intergenic
993309946 5:86316688-86316710 CAGGTATAAGCCACCGTGCTTGG - Intergenic
994327229 5:98462409-98462431 CAGGTACATGCCACCGTGCTTGG - Intergenic
994934174 5:106232103-106232125 CATGAGCAAGACACAGTGTTGGG + Intergenic
995143727 5:108762989-108763011 TAAGTAAAATACACAGTGTTAGG - Intronic
995277941 5:110299006-110299028 CAAGTGCAAGCCACCGTGCCTGG - Intronic
996002156 5:118377252-118377274 CAGGTACCAGACACCATGTCTGG - Intergenic
996816964 5:127584777-127584799 CAGGTACAAGCCACCATGCTCGG + Intergenic
998183043 5:139958845-139958867 CAAGTACAGAACAGAGTGTTTGG + Intronic
998310086 5:141121688-141121710 CAACTTCAAGACAACGTATTTGG - Intronic
998524819 5:142832699-142832721 TAAGAGCAAGACACTGTGTTGGG + Intronic
998610227 5:143680657-143680679 CAGGCACAAGCCACCGTGCTGGG + Intergenic
1000221856 5:159222161-159222183 CAGGTGCAAGCCACCGTGTTTGG - Intergenic
1001780672 5:174366347-174366369 TAAGTACGAGACAGCGTGGTGGG + Intergenic
1003864711 6:10352355-10352377 TAGGTACCAGACACTGTGTTAGG + Intergenic
1004584737 6:16988578-16988600 CAAGTGCATGCCACCATGTTTGG - Intergenic
1004948683 6:20644108-20644130 CAGGCACAAGCCACCGTGTCTGG + Intronic
1005524542 6:26632949-26632971 CAGGTATAAGCCACCGTGTTTGG + Intergenic
1006783270 6:36647203-36647225 CAGGCACAAGCCACCATGTTGGG + Intergenic
1011077773 6:83455617-83455639 CAAGTGCGAGCCACCGTGTCTGG + Intergenic
1011837614 6:91452911-91452933 CAAGTATAAGCCACCGGGCTGGG - Intergenic
1013316907 6:108951916-108951938 AAAGTACACGACACCCTGTGTGG + Intronic
1013569497 6:111407655-111407677 CAAGCACAAGCCACTGTGCTCGG - Intronic
1013635792 6:112027969-112027991 CATGTGCAAGACATTGTGTTTGG - Intergenic
1014042255 6:116841859-116841881 CAAGTGCCAAACACCCTGTTTGG + Intergenic
1022591958 7:31671918-31671940 CAAGTACAAAAGACCTTGTGGGG - Intergenic
1025713196 7:63930643-63930665 CAAGTGCAAGAAACCATGTGTGG + Intergenic
1028989321 7:97033293-97033315 CAGGTACATGTCACCATGTTTGG - Intergenic
1029841926 7:103374238-103374260 CAAGTACAATACATCTTGCTAGG + Exonic
1030595835 7:111537806-111537828 CAGGTACCAGCCACCGTGCTGGG + Intronic
1031326711 7:120408853-120408875 CATATTCAAGTCACCGTGTTTGG - Intronic
1033142344 7:138838885-138838907 CAAGTATGAGACACCGTGCCTGG - Intronic
1034326424 7:150237937-150237959 CAAGAAACAGACACCATGTTGGG - Intergenic
1034709649 7:153179783-153179805 TAAGTACGAGACACTGTGGTAGG + Intergenic
1034766789 7:153731320-153731342 CAAGAAACAGACACCATGTTGGG + Intergenic
1034843831 7:154424840-154424862 CAAGTTGAAGGCACTGTGTTAGG + Intronic
1035561923 8:611461-611483 CAAGCACAAAACACCCTGTGGGG + Intergenic
1036222053 8:6929333-6929355 CAAGTCCAGGACACTGTGCTGGG - Intergenic
1038177948 8:25198291-25198313 CAGGTATGAGACACCGTGTCTGG - Intronic
1038456562 8:27675482-27675504 CAAGTGCAAGACTCTGTGCTTGG + Intronic
1039262721 8:35789969-35789991 CAAGTATGAGACACCATGTTTGG - Intronic
1040861669 8:52006036-52006058 CAAGTAGAAGATAATGTGTTTGG + Intergenic
1041921108 8:63182346-63182368 CAAGCACAAGCCACCGTGCCTGG + Intronic
1042216151 8:66430967-66430989 CAGGTACCAGCCACCGTGTCTGG - Intronic
1043294123 8:78643172-78643194 CAAGTATAAGCCACTGTGTCTGG + Intergenic
1043780849 8:84333343-84333365 CAAATAAAACACACTGTGTTAGG + Intronic
1044361229 8:91286516-91286538 CAAGGAATAGACACAGTGTTAGG - Intronic
1045757213 8:105557660-105557682 TAAGTACCAGACAGTGTGTTAGG - Intronic
1049878723 8:145046396-145046418 CAAGTGTAAGCCACAGTGTTGGG - Intergenic
1051461423 9:17320778-17320800 CAGGCACAAGCCACCGTGTCTGG + Intronic
1052067110 9:24035469-24035491 CAGGAACAAGCCACCGTGCTTGG + Intergenic
1055504872 9:76937796-76937818 CAGGTACATGCCACCGTGCTTGG - Intergenic
1055659629 9:78490027-78490049 CAAGTACCAGATACCATGCTAGG + Intergenic
1056740762 9:89252950-89252972 CAATTACAAAAATCCGTGTTTGG - Intergenic
1059618063 9:115972347-115972369 CATGTATAAGACCCCATGTTAGG - Intergenic
1186430822 X:9503031-9503053 CAACTAGAAGCCACGGTGTTGGG + Intronic
1186567164 X:10675965-10675987 CAAGTTCAAGACACTGTGAAAGG - Intronic
1186840624 X:13481428-13481450 CAAGCACGAGCCACCGTGTCGGG - Intergenic
1187861963 X:23691495-23691517 CAAGTACAAGACACCACGCCTGG - Intergenic
1190029615 X:46959430-46959452 TATGTACCAGGCACCGTGTTAGG + Intronic
1191883351 X:65864005-65864027 CAAGAAAAAGACCCCGTGTTGGG - Intergenic
1192047191 X:67688166-67688188 CATGTACAAGGCACCATGCTAGG + Intronic
1193481305 X:82032460-82032482 CAGGTGCCTGACACCGTGTTCGG + Intergenic
1193668528 X:84354469-84354491 CAAGCACCAGAAACAGTGTTTGG - Intronic
1194002404 X:88447110-88447132 CTAGTATAAGTCACCCTGTTGGG + Intergenic
1194544174 X:95212156-95212178 CAGGTGCATGCCACCGTGTTTGG + Intergenic
1194544180 X:95212220-95212242 CAGGTGCATGCCACCGTGTTTGG + Intergenic
1194631185 X:96286210-96286232 CAAATACAAGAGACCGTTTTAGG - Intergenic
1196673102 X:118390197-118390219 CAAGCATAAGTCACCGTGTCCGG + Intronic
1197150186 X:123212138-123212160 TAAGTAAAAGACACCATCTTTGG + Intronic
1198525642 X:137497634-137497656 GAAGTACTAGTCACAGTGTTAGG + Intergenic
1199135155 X:144241473-144241495 CAAATTGAAGACACTGTGTTAGG - Intergenic
1200700687 Y:6399863-6399885 CAAGCACAAGAAACCCTGGTTGG + Intergenic
1201033425 Y:9764835-9764857 CAAGCACAAGAAACCCTGGTTGG - Intergenic
1202040728 Y:20680724-20680746 CAAGTACAAGCCACTGTGCTGGG - Intergenic