ID: 912519386

View in Genome Browser
Species Human (GRCh38)
Location 1:110234775-110234797
Sequence AAGAATAAGGAGAGGCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 486}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912519386_912519395 25 Left 912519386 1:110234775-110234797 CCTGCTTGCCTCTCCTTATTCTT 0: 1
1: 0
2: 4
3: 42
4: 486
Right 912519395 1:110234823-110234845 GCATCTGTGTAGGACCATAGGGG 0: 1
1: 0
2: 0
3: 9
4: 88
912519386_912519390 3 Left 912519386 1:110234775-110234797 CCTGCTTGCCTCTCCTTATTCTT 0: 1
1: 0
2: 4
3: 42
4: 486
Right 912519390 1:110234801-110234823 TTACTCCTCACTCTTACTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 229
912519386_912519394 24 Left 912519386 1:110234775-110234797 CCTGCTTGCCTCTCCTTATTCTT 0: 1
1: 0
2: 4
3: 42
4: 486
Right 912519394 1:110234822-110234844 GGCATCTGTGTAGGACCATAGGG 0: 1
1: 0
2: 2
3: 6
4: 89
912519386_912519393 23 Left 912519386 1:110234775-110234797 CCTGCTTGCCTCTCCTTATTCTT 0: 1
1: 0
2: 4
3: 42
4: 486
Right 912519393 1:110234821-110234843 GGGCATCTGTGTAGGACCATAGG 0: 1
1: 1
2: 0
3: 12
4: 92
912519386_912519389 2 Left 912519386 1:110234775-110234797 CCTGCTTGCCTCTCCTTATTCTT 0: 1
1: 0
2: 4
3: 42
4: 486
Right 912519389 1:110234800-110234822 CTTACTCCTCACTCTTACTCTGG 0: 1
1: 0
2: 1
3: 14
4: 238
912519386_912519392 15 Left 912519386 1:110234775-110234797 CCTGCTTGCCTCTCCTTATTCTT 0: 1
1: 0
2: 4
3: 42
4: 486
Right 912519392 1:110234813-110234835 CTTACTCTGGGCATCTGTGTAGG 0: 1
1: 0
2: 2
3: 17
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912519386 Original CRISPR AAGAATAAGGAGAGGCAAGC AGG (reversed) Intronic
900237381 1:1599246-1599268 AGGAATGAGGAGAGGAGAGCGGG + Exonic
901286101 1:8080088-8080110 AAGAGTAAGAAGAGGGGAGCCGG + Intergenic
901773044 1:11540483-11540505 AAGAGGAAGGAGAGAGAAGCGGG - Intergenic
902254972 1:15182640-15182662 AAGAAAGAGGACAGGCAAGAAGG + Intronic
902255138 1:15184008-15184030 AAGAAGAAGGAAAGGAAAGAAGG - Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
903167759 1:21532863-21532885 AAGAATCAGGACAGGCACCCTGG - Intronic
903314150 1:22487877-22487899 ATGAATCTGGAGAGGCAGGCAGG - Intronic
903352622 1:22727168-22727190 CAGAGCAGGGAGAGGCAAGCTGG + Intronic
903437792 1:23365095-23365117 AAAAATAAAAAGAGGCAGGCCGG + Intronic
903808277 1:26020806-26020828 AAGATCAAGGGGAGGCACGCAGG + Intronic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
905034681 1:34910048-34910070 AAGAATAAGGGGAGGAAAGATGG - Intronic
905872326 1:41412197-41412219 AAAAACAAGGAGAGGCCATCAGG + Intergenic
906139078 1:43522714-43522736 AAGAATGGGGAGAGGGAAGGGGG + Intergenic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906360380 1:45152127-45152149 AAGACCAGTGAGAGGCAAGCAGG + Intronic
906528281 1:46509050-46509072 AAGAATAGGAAGAGGCAACTGGG - Intronic
907720820 1:56970595-56970617 ATGAAACAGGAGAGGCAGGCAGG + Intergenic
908165605 1:61454729-61454751 AAGAATAAGTGGAGGTAAGGTGG - Intronic
908825212 1:68126369-68126391 AGGAGGAAGGAGAAGCAAGCTGG + Intronic
909057504 1:70839136-70839158 AGGAGTAAGCAGAGGAAAGCAGG - Intergenic
909520971 1:76567031-76567053 AAGAATGAGGACAGGGAAGGAGG + Intronic
909660005 1:78071531-78071553 AAGAAGAAGGAGAAGGAAGGAGG - Intronic
910729405 1:90376350-90376372 AAGAACTATGAGAAGCAAGCTGG - Intergenic
911291310 1:96059665-96059687 AAATTAAAGGAGAGGCAAGCAGG + Intergenic
911857561 1:102899810-102899832 GAGAATAAGGTGAGGCAGGAGGG + Intronic
911985322 1:104615707-104615729 AAGATGAAGGGGAGGCAAGCAGG + Intergenic
912191573 1:107347017-107347039 AAGAACAAGGCAAAGCAAGCAGG + Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912393728 1:109323198-109323220 AAGAACAAGGAGAGGGAAAGTGG + Intronic
912519386 1:110234775-110234797 AAGAATAAGGAGAGGCAAGCAGG - Intronic
912860877 1:113212816-113212838 GAGAATGAGAAGAGCCAAGCTGG - Intergenic
912918023 1:113837149-113837171 AAGAAGAAAGAGAAGGAAGCAGG + Intronic
912920034 1:113857671-113857693 AAGAAAAAGGAGAGGGAAATTGG - Intronic
913335972 1:117709233-117709255 AAGGAAAAGGAGGTGCAAGCTGG - Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914385609 1:147166946-147166968 AAGAAAAAAGAAAGGCAAACAGG + Intronic
914416763 1:147491274-147491296 AGGAAACAGGAGAGGCAAGCAGG - Intergenic
914576828 1:148979499-148979521 AAGAAAAAGCAGAGAGAAGCTGG - Intronic
914726095 1:150328977-150328999 CACAATAAGGCGAGGCACGCTGG - Intronic
915373391 1:155371258-155371280 AAGAATAAGGCTGGGCAAGGTGG + Intronic
916272789 1:162961884-162961906 AAGGGTGAGGAGAGGCAAGTAGG - Intergenic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916604661 1:166328821-166328843 AAGAAGAAGGGGAGGGATGCTGG - Intergenic
916920643 1:169462502-169462524 AAGAATAAGGCTGGGCAAGGTGG + Intergenic
917102706 1:171461783-171461805 AAGAAAAAGGAAAGGAAAGGAGG + Intergenic
917775339 1:178327962-178327984 AGAAATAGGAAGAGGCAAGCAGG + Intronic
919150606 1:193692860-193692882 AAAAATCAGGAGAGGAAATCTGG + Intergenic
919631707 1:199965988-199966010 AAAAATAAGGCCAGGCGAGCTGG - Intergenic
920268833 1:204747480-204747502 AAGACTGAGGAGAGGCCAGAAGG - Intergenic
920718348 1:208362991-208363013 AATAATGTGGAGAGGCAAGTTGG - Intergenic
921325264 1:213982557-213982579 AAGACCAAAGAGAGGGAAGCTGG + Intergenic
921541654 1:216423553-216423575 AAGAAAGAGGAGGGGCAAGAGGG - Intergenic
923322806 1:232852661-232852683 AAGAAAAAGGAGAGGAATACAGG - Intergenic
923686845 1:236159631-236159653 AAGAAAAAAAATAGGCAAGCGGG + Intronic
924457120 1:244227846-244227868 AAGAATAGGGAGACTCAGGCTGG - Intergenic
924544845 1:245016802-245016824 AAGAATAAGGCAAGGTAGGCAGG + Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063394946 10:5678004-5678026 AGGAAGGAGGAGAGGGAAGCTGG - Intergenic
1063993009 10:11586759-11586781 AAGTATAAATAGAGGCAAGAGGG + Intronic
1064402517 10:15033479-15033501 AAGAAAAAGGAGAAGAAAGAGGG + Intronic
1064606804 10:17050494-17050516 AAGTATATAGAGAGGAAAGCCGG + Intronic
1066229580 10:33419380-33419402 AAGAATGAGAAGAGATAAGCAGG + Intergenic
1066397417 10:35039863-35039885 AAAAATAAGGCCAGGCAAGGTGG + Intronic
1068813531 10:61283723-61283745 AGGAATTTGGAGAGGCAGGCAGG - Intergenic
1069022500 10:63504577-63504599 ATGAATTTGGAAAGGCAAGCAGG + Intergenic
1069379993 10:67833375-67833397 CAGCATTAGGTGAGGCAAGCAGG + Intronic
1069819715 10:71219976-71219998 AAGAGTAAGGAGAGGTCGGCTGG - Intronic
1070063416 10:73009067-73009089 TAGAATGAGGAGAGGCTAGTTGG - Intronic
1070781280 10:79138662-79138684 AAGAAGAGGGAGAGGCATGGAGG - Intronic
1071718508 10:88120203-88120225 AACAAGAAGGAAAGGGAAGCAGG + Intergenic
1071824285 10:89309332-89309354 AAGAATAGGAAGAGACAAGAAGG + Intronic
1074588734 10:114792584-114792606 AAGAAGAAGGAGCAGCCAGCAGG - Intergenic
1076326320 10:129626271-129626293 ATGGAGAAGGAGAGGCATGCGGG - Intronic
1076364362 10:129912205-129912227 AGGTAGAGGGAGAGGCAAGCTGG + Intronic
1076653012 10:132003086-132003108 AAGAAAAAGGCCAGGCATGCTGG + Intergenic
1077136409 11:1001571-1001593 AGGACTTAGGAGAGGCAGGCCGG + Intronic
1077705425 11:4480707-4480729 AAGATGAAGGGGAAGCAAGCAGG - Intergenic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1077893464 11:6436677-6436699 AAGAACAAAGGGAGGCAAGGAGG + Intronic
1077953293 11:6985812-6985834 AAGAATACAGAGAGCCAAGGAGG + Intergenic
1080308314 11:30860955-30860977 AAAACTAATGAGAGGCAATCAGG + Intronic
1081057206 11:38424756-38424778 CAGAATAAGGTGACGTAAGCTGG + Intergenic
1081177894 11:39951390-39951412 AAGACAAAGGGGAAGCAAGCAGG - Intergenic
1082650728 11:55788674-55788696 AAGAATAAGTAATGACAAGCTGG + Intergenic
1083367205 11:62148546-62148568 AAGAAGAAGGTGAGGGGAGCTGG + Exonic
1083569798 11:63753208-63753230 AAGAATGAGTAGAGCCATGCTGG - Intronic
1083770187 11:64862947-64862969 AAGAGTAAGGAGTGACAGGCGGG + Intronic
1083902867 11:65652180-65652202 AGGGAAAAGGAGAGGCAGGCTGG + Intergenic
1084712964 11:70855478-70855500 AAGAATCAGGAAGGGGAAGCTGG - Intronic
1084772016 11:71349500-71349522 AAGCAAAACTAGAGGCAAGCGGG + Intergenic
1084893212 11:72247182-72247204 AAGAACAGGGGGAGGCAGGCTGG - Intergenic
1084908673 11:72369575-72369597 AAGGCAGAGGAGAGGCAAGCAGG - Intronic
1085134590 11:74074617-74074639 AAGAATAAGGCTAGTCAAGCAGG + Intronic
1085887480 11:80537130-80537152 AATAAAAAGGAGAAGCCAGCTGG - Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088358627 11:108968692-108968714 AAAAATCAGGAGAGTGAAGCAGG - Intergenic
1088725875 11:112634137-112634159 AAGAGAAAGGAAAGGCAAGAGGG - Intergenic
1088806801 11:113359913-113359935 AACAATGGGGAGAGGCCAGCAGG - Intronic
1088873068 11:113909463-113909485 AAGAATAGGAAGGGGCAAGATGG - Intronic
1089718769 11:120391656-120391678 AACAATACTGAGAGGCAATCTGG - Intronic
1089915976 11:122156753-122156775 AAGAATAAGGAAAGGAAGGAAGG + Intergenic
1089938647 11:122392694-122392716 AAGAAGTGGGAGAGGCAGGCGGG - Intergenic
1090026936 11:123175617-123175639 AAGATAAAGGAAAAGCAAGCTGG - Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1090966455 11:131601574-131601596 AAAAAAAAGGAGAGGGAAGGGGG - Intronic
1090979962 11:131710994-131711016 GAGAATAAGGAGAGAGAAGAAGG - Intronic
1091485130 12:879372-879394 AAGAATATGGAAAGGAGAGCAGG - Intronic
1091661756 12:2389455-2389477 TTGAAGTAGGAGAGGCAAGCTGG + Intronic
1092032485 12:5299204-5299226 TATAATAATGAGAGCCAAGCTGG + Intergenic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1093666987 12:21826057-21826079 ATAAATTAGAAGAGGCAAGCAGG - Intronic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1095233732 12:39772623-39772645 AAGAAAAAAGAAAGGCAGGCAGG + Intronic
1095398238 12:41785770-41785792 AAGAATTAAAAGAGGCAAGAGGG - Intergenic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1097417900 12:59336267-59336289 GATAACAAAGAGAGGCAAGCAGG + Intergenic
1097734230 12:63164519-63164541 AAGACTTAGGACAGTCAAGCTGG - Intergenic
1097840033 12:64312609-64312631 AAAAAAAAGGAGAGGCAAAGAGG + Intronic
1097904772 12:64908492-64908514 AGAAATAATGAGAGGCAAACTGG - Intergenic
1098337485 12:69419070-69419092 AAGAATGAGCAGAGGTGAGCAGG - Intergenic
1098428081 12:70389098-70389120 AAGAATAAAGAGAGGAAAATGGG - Intronic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100991356 12:100254708-100254730 AAGAAGAAAGAGAGGGAAGGAGG - Intronic
1101063025 12:100991013-100991035 AAGAAAAAGCAGAGGACAGCTGG + Intronic
1102075485 12:110056589-110056611 AAGAAGAAAAAGAGGAAAGCTGG + Intronic
1102703315 12:114859289-114859311 AAGAGGAAGTAGAGGCAAGGGGG - Intergenic
1103226872 12:119295342-119295364 AGGAAAAAGGAGAGGTGAGCGGG + Intergenic
1104371459 12:128227516-128227538 AAGAAGAAAGAAAGGCAAGGTGG + Intergenic
1104382956 12:128323890-128323912 AAGAACAAGGAAAGGCAAGGAGG + Intronic
1104543394 12:129687755-129687777 AAGAAGATGCAGAGCCAAGCAGG - Intronic
1104620713 12:130310722-130310744 AAAAATAAGGAAGGACAAGCTGG + Intergenic
1104877911 12:132049321-132049343 AAGAGTAAGCAAAGGGAAGCAGG - Intronic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106574725 13:30963955-30963977 GTGAAATAGGAGAGGCAAGCTGG - Intronic
1107961424 13:45562806-45562828 AGGATTCAGGAGAGGCAGGCAGG + Intronic
1108008144 13:45973862-45973884 AAATGTAAGGAGAGGGAAGCAGG + Intronic
1108362491 13:49679925-49679947 AGTAATAAGGAGAGGCAGGCTGG + Intronic
1108584973 13:51863233-51863255 AAGGAGAGGGAGAAGCAAGCTGG + Intronic
1109062055 13:57632374-57632396 CAGAATAAGGAGAGACCACCGGG + Exonic
1111235087 13:85399459-85399481 AAAAAAAAAGAGTGGCAAGCTGG - Intergenic
1111240419 13:85466237-85466259 AAGACAAAGGGGAAGCAAGCAGG + Intergenic
1111532026 13:89550013-89550035 ACGAATATGAAGAGGCAAGAGGG + Intergenic
1111686860 13:91512889-91512911 AATAATAATGAGAACCAAGCTGG - Intronic
1112700192 13:101999066-101999088 AAGACTAGGGAGAGGCAGACTGG + Intronic
1114416463 14:22548110-22548132 AGAAATAAGGAGAGGCAACTTGG - Intergenic
1114440837 14:22746229-22746251 AAGAATAAAAAGGGGAAAGCAGG + Intergenic
1114491159 14:23102889-23102911 ATGAATAGGGAGAAGCAAACAGG - Intergenic
1114868117 14:26622806-26622828 AAGAATTTGGAGAGGCATTCCGG - Intergenic
1114882734 14:26806873-26806895 AAGAATAAAGAGGAGAAAGCAGG - Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1116525568 14:45900091-45900113 AAGAGTAAAGAGAGGCTTGCAGG + Intergenic
1117390946 14:55262011-55262033 AAGAATAAGGACAGGCTGGCTGG + Intergenic
1118088446 14:62445502-62445524 AAGAAAAAGGAGGGGCATTCAGG - Intergenic
1118736576 14:68705469-68705491 AAGAACAAGGAAAGGTCAGCAGG + Intronic
1118923607 14:70171812-70171834 AAGAAAAAGAAAAGGCAAGGCGG + Intronic
1119063759 14:71504435-71504457 GAGAATAGAGAGAGGAAAGCTGG - Intronic
1120440438 14:84530423-84530445 AAGAATAAATAGAAGCTAGCAGG + Intergenic
1121434361 14:93909395-93909417 AAGGATACTGAGAGGCAAGAGGG + Intergenic
1121969744 14:98345096-98345118 AAGAAGAAAGAGAGGCACCCAGG + Intergenic
1122496349 14:102158637-102158659 AAGAATAAGGATAGGGAAGTAGG - Intronic
1122673315 14:103389066-103389088 AAGACTAAGAAAAGGCAGGCCGG + Intronic
1123135519 14:106024110-106024132 AAGAATCATTAGAGGCTAGCAGG - Intergenic
1123757280 15:23406788-23406810 AAGAAAAAGGACAGGCATGGTGG - Intergenic
1124232271 15:27955845-27955867 ATGAAAAAGAAGAGGCAAGTGGG - Intronic
1125253713 15:37737481-37737503 AAGGAGAAGGAAAAGCAAGCAGG - Intergenic
1125876867 15:43155889-43155911 CAGAATAAGAAAAGGCAAACTGG - Intronic
1126129107 15:45323560-45323582 AGGAACAAAAAGAGGCAAGCAGG - Intergenic
1126211158 15:46102652-46102674 AAGAATTAGGAGAGACAAAAAGG - Intergenic
1126663210 15:51052318-51052340 CAGAAAAAGGAGAGGTCAGCTGG - Intergenic
1127356316 15:58204251-58204273 AAAAAGAAGGAAAGGCAAGAGGG + Intronic
1127690778 15:61394838-61394860 TAGAATAAGGAGAGGAGACCTGG + Intergenic
1128095607 15:64952228-64952250 AAGAATAAGAAGAAGAAAGGAGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128128529 15:65210527-65210549 AAGGGTCAGGAGAGGAAAGCAGG + Intronic
1128226614 15:66006176-66006198 AAGGAAGAGGAGAGGCAGGCTGG + Intronic
1128839685 15:70840168-70840190 ATGAAAAAGGAGATGCAAGATGG + Intronic
1129384351 15:75187678-75187700 AAGGATAAGGCCAGGCAAGGTGG - Intergenic
1129513097 15:76139347-76139369 ACAAAAAAGGATAGGCAAGCAGG + Intronic
1130208731 15:81902901-81902923 AAGAATAAGAAGAAACAACCAGG - Intergenic
1130226076 15:82059087-82059109 AAGAAGAAGGAGGGGCAAGGGGG - Intergenic
1130585198 15:85175255-85175277 AAGAAAGAGGAGAGGAAAGGAGG + Intergenic
1131191247 15:90318678-90318700 AAGAATCTGGAGAGACAGGCTGG - Intergenic
1133364370 16:5199009-5199031 AAAGCTAAGCAGAGGCAAGCAGG - Intergenic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1134634672 16:15783316-15783338 AAAAATAAGGAAGGGAAAGCAGG - Intronic
1135241691 16:20812652-20812674 AGGTATGAGGAGAGGGAAGCAGG - Intronic
1136017567 16:27412376-27412398 AAGGAGAAGGAGAAGAAAGCTGG - Intronic
1137486417 16:48895177-48895199 ATGAATCTGGAGAGGCAGGCAGG + Intergenic
1137910232 16:52370573-52370595 AAGAATAAGGAAATGCAGACAGG - Intergenic
1138983205 16:62295711-62295733 AAGAATAAGGCCAGGCATGGTGG + Intergenic
1139004270 16:62551536-62551558 AAGAACAAGGAAAGGAAAGGGGG - Intergenic
1139333090 16:66209375-66209397 AAGGAGAGGGAGAGGCAATCAGG - Intergenic
1139503358 16:67386455-67386477 AAGAAGAGGCAGAGGCAGGCCGG + Intergenic
1139770830 16:69274975-69274997 AAGAAAAAGGAAAGGGAAGGAGG - Intronic
1140119809 16:72073857-72073879 AACAAGAAGGAGCGGAAAGCTGG - Intronic
1141076371 16:81009436-81009458 AAAACCAAGGAGAGGGAAGCAGG + Intronic
1141489549 16:84362912-84362934 AGGAGTCAGGAGAGGCAAGAAGG - Intergenic
1142607385 17:1089661-1089683 AAGAAGAAGGAAATGCAGGCCGG + Intronic
1144013848 17:11175070-11175092 CAGACTATGGAGAGGCAAGCAGG + Intergenic
1144042233 17:11422288-11422310 AACAAAAATGAGAGGCAAGAGGG + Intronic
1144153972 17:12480109-12480131 TACAATAAGGAGAGGCATCCAGG + Intergenic
1144429822 17:15181072-15181094 AAGAATAAGGACACACAGGCCGG - Intergenic
1144577520 17:16438409-16438431 AGGAATGAGGAGAGGAAAGGAGG + Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1145783932 17:27582033-27582055 AAGAGTTAGGAAAGGGAAGCTGG - Intronic
1147121417 17:38337479-38337501 GAGAGGCAGGAGAGGCAAGCAGG - Intronic
1147441875 17:40452567-40452589 AAAAATCAGGAGAGGCAACAGGG + Intronic
1147602368 17:41754476-41754498 AAGGACTAGAAGAGGCAAGCTGG - Intergenic
1148467554 17:47873959-47873981 AAGAAGAAAGAGAGGAAAGGAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148737299 17:49872071-49872093 AAGAATTAGGCCAGGCAAGGTGG - Intergenic
1149360463 17:55889617-55889639 AAGAGGAAGAAGAGGGAAGCTGG - Intergenic
1149623750 17:58065073-58065095 CAAAATAAGGAGAGGCCTGCTGG - Intergenic
1149735661 17:58991246-58991268 AAGAATAAGGCCAGGCAGGGTGG + Intronic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150528376 17:65949625-65949647 AAGAAGAAGGAGACTCAAGTAGG + Intronic
1150645751 17:66976529-66976551 AAGAATAAAGAGAGGAAGGAGGG - Intronic
1152765027 17:82131963-82131985 AAAAATAAGGCCAGGCATGCTGG + Intronic
1152829330 17:82487497-82487519 AAGAAGAATGAGAGGCACACGGG + Intronic
1155221922 18:23693054-23693076 AAAAATATGGAGAGGCATGGTGG + Intronic
1155304060 18:24462134-24462156 AAGAATGAGCAAAGGCATGCTGG + Intronic
1155514303 18:26608617-26608639 AAGAATAATGAGGGGGCAGCGGG - Intronic
1155735548 18:29218376-29218398 AAGACTAAGAAGAGTAAAGCTGG + Intergenic
1156261802 18:35451457-35451479 AAGGATAAGGAGAGGGAAAAGGG + Intronic
1157214701 18:45773176-45773198 AAGGAGAAGGAGAGGGAAGGAGG - Intergenic
1157277824 18:46324296-46324318 ATGCACAAGGAGAGGCAAGCAGG - Intergenic
1159109676 18:64042391-64042413 AAGAAGATGGAGAGGCAGGATGG + Intergenic
1159622279 18:70651958-70651980 GATGGTAAGGAGAGGCAAGCTGG + Intergenic
1159642165 18:70876441-70876463 AAAAAAAAAGAAAGGCAAGCTGG - Intergenic
1159673278 18:71250011-71250033 AAGAAACAGGATAGGGAAGCAGG - Intergenic
1160147959 18:76379499-76379521 AAGAATAAGGAGAGCCATTCCGG - Exonic
1161814201 19:6489368-6489390 AGGAGTAAGGAGAGGCATGAGGG - Intergenic
1162898929 19:13782485-13782507 AACAATAAGGAAAGGAAAGAAGG + Intergenic
1163350755 19:16775371-16775393 AAGCAAAAGCAGAGGCAAGAGGG + Intronic
1164023309 19:21328369-21328391 GTGAATTAGGAAAGGCAAGCTGG + Intronic
1164249734 19:23466305-23466327 AAAAATAAGGAGAGGAGAGGAGG - Intergenic
1164629469 19:29752686-29752708 AAGTAGAAAGAGAGGCCAGCAGG - Intergenic
1164678387 19:30118161-30118183 CACAATAAGGAGAGGCCACCAGG - Intergenic
1164918094 19:32067955-32067977 AAGGGTAAGGAGAAGCAAGAAGG - Intergenic
1165383577 19:35497391-35497413 AGAAACAAGGAGAGACAAGCTGG + Exonic
1166008624 19:39925126-39925148 AAGAAGAAGAAGAGGGAAGGGGG + Intronic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1166738762 19:45101720-45101742 AAGAAAAAGGAGGGGCATGGTGG + Intronic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925186717 2:1851997-1852019 AAGAATGAGGGGAGGAAAGGCGG - Intronic
926517154 2:13861898-13861920 AAGGATAATTAGAGGCAAGAGGG + Intergenic
927634972 2:24807256-24807278 AAGACTAGGAAGAGGCAAACTGG - Intronic
928341096 2:30443806-30443828 AGGAGTCAGGAGAGGAAAGCCGG + Intergenic
928484894 2:31719891-31719913 AATAATACAGAGTGGCAAGCTGG + Intergenic
929585997 2:43114847-43114869 AGGATTCAGGAGAGGCATGCGGG - Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
933674331 2:85040491-85040513 AAGAAAAAGGAGAGCAAAGCGGG - Intronic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
935146171 2:100397057-100397079 CAGCATCAGGAGTGGCAAGCAGG + Intronic
935223039 2:101031357-101031379 AGGAATAAGGAGGGGCAGGTGGG - Intronic
935401242 2:102662661-102662683 AAGGACAAGGAAAGGAAAGCAGG + Intronic
935612820 2:105043583-105043605 AAGAAAAAAGAAAGGAAAGCAGG - Intronic
935787719 2:106563908-106563930 AAGAGGAAGGAGAGGCAAGGTGG + Intergenic
936880114 2:117240286-117240308 GAGGAGAGGGAGAGGCAAGCAGG + Intergenic
937153885 2:119704606-119704628 AAGAAGAAGGGGAGGAAAGGAGG + Intergenic
937617856 2:123947201-123947223 AAGTATAAGGAGAGAAAAGAAGG + Intergenic
939252660 2:139702495-139702517 TAGAATAAAGAAAGGCAAGTTGG - Intergenic
940241562 2:151568425-151568447 AAAAAAAATGAGAGGCAAGGGGG + Intronic
940410124 2:153352394-153352416 AAGAATAAAAAGAGGCAAACTGG - Intergenic
944153084 2:196582891-196582913 AACAATAAGGTGAGCCAAGTGGG + Intronic
945395965 2:209317852-209317874 AGGAATAAGGAGAAGCTAGGAGG + Intergenic
946060141 2:216934440-216934462 AAGAAGAAAGAAAGGGAAGCAGG - Intergenic
946294611 2:218773966-218773988 AAGAAGAAAGAGAGGGAAGAAGG - Intergenic
947077016 2:226355732-226355754 AAGAGGAAGGAGAGGAAAGGAGG + Intergenic
947374574 2:229482615-229482637 AAGAATCATGAGAGGGATGCAGG + Intronic
948212250 2:236203449-236203471 ATGAAACAGGAGAGGAAAGCAGG + Intronic
1168817030 20:745008-745030 AAGAATAAGGGAAGGTAGGCTGG + Intergenic
1169076982 20:2767314-2767336 AAGAATAAGGCCAGGCATGGTGG - Intergenic
1169982790 20:11405415-11405437 AAGAATAAAAGGAGGCCAGCCGG + Intergenic
1170134111 20:13054230-13054252 AAGACTGCTGAGAGGCAAGCAGG + Intronic
1170223565 20:13966284-13966306 AAGAAGAAGAAGAGGCAAGAAGG - Intronic
1171390980 20:24801659-24801681 AGTAATAAGGAGAGCCAGGCTGG - Intergenic
1172545147 20:35754939-35754961 AAGAAGAAGAAGAAGAAAGCAGG - Intergenic
1172598339 20:36166058-36166080 AATCATCAGGAGAGGCAGGCTGG + Intronic
1173092468 20:39986277-39986299 TAGAAACAGGAGAGGCAAGCGGG - Intergenic
1174045656 20:47730815-47730837 AAGAATAAGGAAAAGCATACTGG - Intronic
1174057625 20:47809610-47809632 AGAAATAAGGAGCGGCCAGCGGG + Intergenic
1174662534 20:52226673-52226695 AAGAAGAAGGAGAGAGAAGGTGG - Intergenic
1174978935 20:55369882-55369904 AAGAAGAAGCAGAGGAAAGCGGG + Intergenic
1175015647 20:55787140-55787162 AAGAATGAGGAGAGGCAAGTGGG + Intergenic
1175293720 20:57894807-57894829 AAGAAGAAGGAGGGGGAAGGAGG + Intergenic
1175322697 20:58100503-58100525 CAGCACAAAGAGAGGCAAGCGGG - Intergenic
1175448557 20:59043095-59043117 AAGGACAAGGAGGGCCAAGCGGG - Intergenic
1175642693 20:60644043-60644065 AATAAAATGGAGAGGCAAGAAGG + Intergenic
1177166535 21:17611586-17611608 AAGAACCACCAGAGGCAAGCAGG + Intronic
1177342170 21:19817528-19817550 AAGAATAATGAGAGAGAAACAGG + Intergenic
1177543186 21:22521560-22521582 AAGAATTAATAGAAGCAAGCAGG + Intergenic
1177691542 21:24516383-24516405 AACACTAAGGAAAAGCAAGCTGG - Intergenic
1177861534 21:26460237-26460259 AAGAAAAAGGAGAGTGAAGATGG - Intergenic
1178225369 21:30710928-30710950 AAGGGAAAGGAGAGGCAAGAAGG + Intergenic
1178317446 21:31578454-31578476 AAAAATAAGGCCAGGCAAGGTGG + Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1180025324 21:45157888-45157910 AAGAATACAGAGAAGCACGCAGG + Intronic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1181951749 22:26558723-26558745 AGGAACAGGGTGAGGCAAGCAGG + Intronic
1182285867 22:29246585-29246607 GAGAACCAGGAGAAGCAAGCAGG + Intronic
1182942007 22:34285876-34285898 AGGAAAAAGGAGAGGAAACCAGG - Intergenic
1183036150 22:35142345-35142367 AAGAATAAGGAAAGGAAAGAGGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183837401 22:40466509-40466531 AAGAAAAAGGAGAGCCAAGCAGG + Intronic
1185028613 22:48429838-48429860 CAGAATCAGGAGAGTCCAGCTGG + Intergenic
949725988 3:7045404-7045426 AAGGATAAGAAGAGGCAAGAGGG + Intronic
950096493 3:10333733-10333755 ATGAAGAGGGAGAGGCAAGATGG + Intronic
950980757 3:17302110-17302132 CAGAAGCAGGAGAGGCAAGGAGG - Intronic
953062615 3:39439871-39439893 ATGAATCTGGAGAGGGAAGCAGG - Intergenic
953329185 3:42037947-42037969 AGGAAAAAGGAGAGGCTATCTGG - Intronic
953481008 3:43252077-43252099 AAGAATAAGGCTAGACAAGAGGG - Intergenic
953768198 3:45760081-45760103 GTGAATAGGGACAGGCAAGCTGG - Intronic
954053624 3:48003872-48003894 AAAAATATGAAGAGGCAAGAGGG + Intronic
954080006 3:48208012-48208034 ATGAATATGGAGAGGGCAGCTGG - Intergenic
954724310 3:52594536-52594558 AAGAAACAAGAGTGGCAAGCTGG - Intronic
954871119 3:53768163-53768185 CAGAATAGGGAGAGGCCCGCAGG + Intronic
955626317 3:60923470-60923492 AAGATTAAGTAAATGCAAGCTGG + Intronic
956049964 3:65237222-65237244 AACAATAGTGAGAGCCAAGCTGG + Intergenic
956060908 3:65347108-65347130 AAGAAAAAAGGGAGGCAAGAAGG - Intergenic
956660884 3:71596202-71596224 AAGGAGGAGGAGAGGAAAGCAGG - Intergenic
957538528 3:81537797-81537819 AAGAATAAGCATAAGCATGCAGG - Intronic
957540923 3:81567952-81567974 AAGAAATAGGAAAGGCAGGCAGG - Intronic
959089182 3:101884142-101884164 AAGAAAAACGAGATGCCAGCTGG + Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959348976 3:105236491-105236513 AAGAAGAACTAGAGGAAAGCTGG + Intergenic
959903910 3:111689699-111689721 AAGAAGAAGGAGGGGAAAGATGG + Intronic
960055571 3:113274271-113274293 AAGAAGACAGAGAGGCAACCTGG - Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
962075908 3:132081419-132081441 AACAATCAGGAGAGGCTTGCTGG + Intronic
962935082 3:140073454-140073476 AAGAATGGTGAGAGCCAAGCTGG + Intronic
963013942 3:140802992-140803014 AAGAATCTGGAGAGGCAGTCTGG + Intergenic
963308260 3:143678120-143678142 AAGACTATGAAGAGGCAGGCTGG - Intronic
963569780 3:146978890-146978912 AAGAAAAAGGAAAAGCTAGCTGG - Intergenic
964577786 3:158194330-158194352 AAGAAAAAGGAAAGGAAAGGAGG + Intronic
964594459 3:158408499-158408521 AGGAATAAGGAAAGGCAAATAGG + Intronic
964984391 3:162721609-162721631 AAGAATAAGGAGGGGGTAGAAGG + Intergenic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
966087048 3:176080510-176080532 AAGAGAAGGGAGATGCAAGCAGG - Intergenic
966301850 3:178487939-178487961 AAGACTTAGGTGACGCAAGCAGG - Intronic
966521900 3:180882344-180882366 AAGAAGAAGGAGACGGAAGAAGG - Intronic
967159502 3:186722881-186722903 AAGGAAAAGGAGAGGCAAGAAGG - Intronic
967298928 3:187993233-187993255 AAAAAAAGCGAGAGGCAAGCAGG + Intergenic
968797028 4:2713719-2713741 AACACTCAGCAGAGGCAAGCGGG - Intronic
968962085 4:3750764-3750786 AAGGCTCAGGAGAGCCAAGCAGG - Intergenic
969869895 4:10098088-10098110 AAGAACAAGATGGGGCAAGCCGG + Intronic
971348557 4:25835291-25835313 AGGCATAAGGAAAGCCAAGCAGG + Exonic
971420268 4:26467987-26468009 AAGAAGAAGAAGAAGAAAGCGGG + Intergenic
971959360 4:33465306-33465328 AACAACAAGGAGGGGCGAGCTGG - Intergenic
972028055 4:34412135-34412157 AAAAAGAAGAAGAGGCAAGATGG - Intergenic
972127656 4:35789725-35789747 AAAAATAAGGAGAGACAAAAGGG - Intergenic
973024097 4:45245424-45245446 AAGAAAATGGAGAGATAAGCAGG + Intergenic
973048888 4:45570421-45570443 AGGAATAAGGACAGGGAAGAAGG + Intergenic
975644067 4:76528848-76528870 AAGAATAGGGAGAGGAAGACCGG - Intronic
975767825 4:77687602-77687624 AAGAATGAGGAGAGGAAGGAAGG + Intergenic
976253048 4:83072851-83072873 AAAAAAAAGGAGTGGGAAGCAGG - Intronic
977686669 4:99854587-99854609 ATGAAGACAGAGAGGCAAGCAGG - Intronic
977914415 4:102575487-102575509 AAGAATTCAGAGAGGTAAGCAGG - Intronic
978184173 4:105837382-105837404 AAGAAAAAGGTGAGGTAAGCAGG - Intronic
979367613 4:119844076-119844098 TAGATTAAGGAGAGGAAAGGGGG + Intergenic
980170096 4:129278790-129278812 GGGAGAAAGGAGAGGCAAGCTGG + Intergenic
981384960 4:144119082-144119104 AAAAATAAGGAGAAGAAAGGAGG + Intronic
981638614 4:146910490-146910512 ACAAATGAGGAGTGGCAAGCAGG + Intronic
984498027 4:180522852-180522874 AAGAATAAAGAGTGACAAGTAGG + Intergenic
986284059 5:6347154-6347176 AGGAATGAGGAGAGGGAACCTGG - Intergenic
986442245 5:7792685-7792707 AATAATAAGGAAAGGCAAGATGG + Intronic
986786890 5:11122976-11122998 AAGGATAAGGAGAGGCTGTCTGG + Intronic
987827782 5:23055847-23055869 GAGAATAAGGAGAGTGAAGGAGG + Intergenic
988403869 5:30799046-30799068 AAGAATAAAGAGAAGAAAGGAGG + Intergenic
988813424 5:34807244-34807266 CAGAATAAGATGAGCCAAGCAGG + Intronic
988869457 5:35372916-35372938 AAAAAGAAAGAGAAGCAAGCAGG - Intergenic
990184564 5:53199750-53199772 AAGAATATGGTGATGCATGCAGG - Intergenic
990325261 5:54669187-54669209 AAGAATAAGCACAAGCCAGCTGG - Intergenic
990334616 5:54759961-54759983 AAGAATAAGGAGAGGCCAGAAGG + Intergenic
990624786 5:57598689-57598711 AAGAGGAAGCAGAGGCAAGGAGG - Intergenic
990738717 5:58890936-58890958 AAGAACAGGCAGAGGAAAGCAGG - Intergenic
991158065 5:63461420-63461442 AAAAATGAAGAGTGGCAAGCTGG + Intergenic
991431201 5:66549365-66549387 AAGGTGAAGGGGAGGCAAGCTGG - Intergenic
991625728 5:68599041-68599063 AAGAACAAATAGAGGCAAGTTGG - Intergenic
991917445 5:71619144-71619166 AATAATAAGCTAAGGCAAGCGGG - Intronic
992473292 5:77077860-77077882 CAGAATGAGGAGTGGCGAGCCGG - Exonic
993165472 5:84348416-84348438 TGGAAAAAGGAGAGGCAAGATGG - Intronic
993343757 5:86756840-86756862 AAGACTAAAGAAAGGAAAGCTGG - Intergenic
993866790 5:93205423-93205445 ATGAATGGGGAGAGGAAAGCTGG + Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994078899 5:95684128-95684150 GAGAGTCATGAGAGGCAAGCAGG - Intronic
994153126 5:96473039-96473061 AAGAGAAAGGAGAGGGAAACTGG - Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994379409 5:99053541-99053563 AAAAAAAAAGACAGGCAAGCTGG - Intergenic
996408646 5:123131018-123131040 AAGAATAAAGAAATGTAAGCAGG - Intronic
996902083 5:128553918-128553940 AAGACTCAAGAGTGGCAAGCTGG + Intronic
997779159 5:136639851-136639873 AAGAACAGGGTAAGGCAAGCAGG + Intergenic
998392551 5:141796594-141796616 AGGAATAAGGAGACGCCAGCAGG - Intergenic
999222855 5:149995867-149995889 AAGATTAATGAGTGGCATGCAGG - Exonic
1001445140 5:171777041-171777063 AAAAAAAAGGAGGGGGAAGCTGG - Intergenic
1001480992 5:172089160-172089182 AAGGATAAGGGGAGGAGAGCTGG - Intronic
1001582105 5:172805964-172805986 AAGAGAAAGGAGAAGCAAGGCGG - Intergenic
1001607936 5:172976698-172976720 AAGAAATAGGAGAGGCAACATGG + Intergenic
1001711139 5:173779139-173779161 AAGAGGTAGGAGAGGCAAGCAGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001809851 5:174619304-174619326 ATGAATTATGAGAGGAAAGCAGG - Intergenic
1002038413 5:176491584-176491606 AAGGAGAAGGAGGGGCAAGTAGG + Intronic
1003058585 6:2844130-2844152 AAGAATTTGGAGATGCATGCTGG - Intergenic
1004121450 6:12826513-12826535 TAGAATAACAAGAGGCAAACTGG - Intronic
1004255236 6:14057733-14057755 AAAAATAAATAGAGGCAGGCAGG + Intergenic
1005366385 6:25082552-25082574 GAGAATAAGGAGAGTTAAGAGGG - Intergenic
1007221352 6:40281609-40281631 AATAATAAGGAGATGAGAGCAGG - Intergenic
1007562517 6:42821990-42822012 AAGAAAAGGGAGAGGAAAACAGG - Intronic
1007760425 6:44130072-44130094 AAGCAAGAGGAAAGGCAAGCAGG + Intronic
1009820930 6:68800215-68800237 CAGAAAAAGAAGAGGCAAGGAGG + Intronic
1010444087 6:75931890-75931912 AAGGATAAGGAAGGGCAAACAGG - Intronic
1010953040 6:82059532-82059554 AAGAATGATGAAAGCCAAGCTGG - Intergenic
1011223782 6:85085179-85085201 AAGAAGAAGGAAAGGAAAGGAGG + Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012214456 6:96564783-96564805 AAGAACAAGGAAATGCAAGCTGG - Intronic
1012254611 6:97017247-97017269 ATTAATAAGCAGAGCCAAGCTGG + Intronic
1012585574 6:100918138-100918160 AGGAAAAAGGAGAGGCATGCAGG + Intergenic
1012675812 6:102110750-102110772 AAAAATAAGGGGAGGAAAACTGG + Intergenic
1014302131 6:119694802-119694824 ATGAGGAAGGAGAGGCAAGAAGG - Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016476636 6:144434412-144434434 AAGATGAAGGAGAGAGAAGCTGG + Intronic
1016734705 6:147464707-147464729 AAGAATAGGGAGAGGAAGGAAGG - Intergenic
1017238515 6:152141772-152141794 AAAAATAAGCAGAGGTAGGCTGG + Intronic
1019106584 6:169672724-169672746 AAGAATAAGGAGAGGAATGAGGG + Intronic
1019988000 7:4672178-4672200 AAGAAAAAGGAAAGACAAGGTGG + Intergenic
1020646436 7:10819873-10819895 AAGAATTAAGAGAAGCAACCTGG + Intergenic
1021264199 7:18498772-18498794 AAGAATGCTAAGAGGCAAGCAGG - Intronic
1021298577 7:18941184-18941206 AAGAATAACGGGAGGGAGGCAGG - Intronic
1021402567 7:20226268-20226290 ATGGATAAAGAGAGGCCAGCTGG - Intergenic
1021796946 7:24265354-24265376 AAGAAGCAGGAGAAGCAAGCAGG + Intergenic
1021885107 7:25130267-25130289 AAGAAAAAAGAAAAGCAAGCTGG + Intergenic
1022180788 7:27917306-27917328 GAGAGTGAGGAGAGGCACGCTGG - Intronic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022286769 7:28961085-28961107 AAGAATCTGGAGATGCAGGCTGG + Intergenic
1022931947 7:35127051-35127073 AACAAAAAGGAGATGCAAGAAGG - Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023275082 7:38510253-38510275 AAGAAGAGGGAGAGGCAACAGGG - Intronic
1024602918 7:51000908-51000930 AAGAATAAAGAGATACGAGCAGG - Intergenic
1024731129 7:52254978-52255000 AAGAAAAAGGAGAAGAAAGAGGG + Intergenic
1026451160 7:70530796-70530818 AAGCAGTAGGAGAGGAAAGCAGG - Intronic
1026661869 7:72309616-72309638 ATGAATCAGAAGTGGCAAGCAGG + Intronic
1026784661 7:73294908-73294930 AAGACTTAGGAGAGCTAAGCCGG - Intergenic
1027109409 7:75425020-75425042 AAGACTTAGGAGAGCTAAGCCGG + Intronic
1027676126 7:81160983-81161005 AAGAATGAGGAGAGCCAGCCGGG + Intergenic
1028759876 7:94483924-94483946 AAGGATTAGAAGAAGCAAGCCGG - Intergenic
1029469550 7:100745588-100745610 AAGAAAAGGAAGAGGCAATCGGG + Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029677068 7:102077136-102077158 TAGAATAAGGTGAATCAAGCAGG + Intronic
1029901981 7:104051258-104051280 GAGAATAAGAAAAGGAAAGCTGG - Intergenic
1030091660 7:105863549-105863571 AGGACTAAGGGGAAGCAAGCAGG - Intronic
1030161960 7:106518395-106518417 GAGAAATAGGAGAGGCAAGAAGG - Intergenic
1030241549 7:107331829-107331851 AAAAAAAAAAAGAGGCAAGCAGG - Intronic
1030346493 7:108439556-108439578 AATAAAAAAGACAGGCAAGCCGG + Intronic
1032017247 7:128388089-128388111 AAGAAAGAGGACAGGGAAGCAGG + Intergenic
1033040560 7:137913901-137913923 CAGAATAAGGAGGGGCCAGGGGG + Intronic
1033114112 7:138610017-138610039 AATAATAAGGCTAGGCATGCTGG - Intronic
1033227939 7:139575541-139575563 AAGAATCAGGAGAGGCAAGGTGG + Intronic
1033778512 7:144641572-144641594 ATGAATGAGGAGAGGCAGGCAGG + Intronic
1034290046 7:149923435-149923457 AAACACAAGGAGAAGCAAGCAGG + Intergenic
1034661022 7:152769411-152769433 AAACACAAGGAGAAGCAAGCAGG - Intronic
1036279843 8:7391327-7391349 AAAAAGAAGGAGGGGCAAGGAGG + Intergenic
1036341677 8:7920556-7920578 AAAAAGAAGGAGGGGCAAGGAGG - Intergenic
1037045695 8:14300288-14300310 AAGAATAAAGGGAGGGAAGGAGG + Intronic
1037601567 8:20400628-20400650 AAGAATAAGTAAAGGGAAGATGG - Intergenic
1039706481 8:40012718-40012740 AAGACAAAGGAGAGGAAAGGTGG + Intronic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1040027260 8:42793118-42793140 AAGAAAAAGGAAAGGGAAGGTGG + Intronic
1040654247 8:49486416-49486438 CAGAAAAGGGAGAGGCAAGCTGG - Intergenic
1041332474 8:56741592-56741614 CAGAAAAAGAAGAGGCAAGGAGG + Intergenic
1042142374 8:65692332-65692354 AAGAAAAAGAAAAGACAAGCAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042379911 8:68101799-68101821 AAGAATGAAGAGAGGAAAGCAGG - Intronic
1042440487 8:68820484-68820506 AAGAGTAATGAGAGCCAAGAGGG - Intergenic
1042777455 8:72449224-72449246 AAGAATAAGGAGATGAGAGCAGG - Intergenic
1043393179 8:79810737-79810759 AAGAATAATGATAGGCTGGCTGG - Intergenic
1044478495 8:92656560-92656582 AAGAATAAGGAAAACAAAGCTGG + Intergenic
1045844589 8:106618621-106618643 AAGAATAAGGTAAGGCAACATGG - Intronic
1045917307 8:107487263-107487285 AATAAAAAGGAGAGACAGGCCGG + Intronic
1046923322 8:119758192-119758214 ATGAATAATGAGTGACAAGCAGG + Intronic
1046990706 8:120449693-120449715 AAGAATAAGGAGCAGCCAGAAGG + Intronic
1047119887 8:121890250-121890272 AAAAACAAAGAGTGGCAAGCTGG - Intergenic
1047483268 8:125304965-125304987 AAGAAAAAGGAAAGGAAAGAGGG + Intronic
1047845451 8:128800769-128800791 AAGAGTAAAGAGAGGAAAGAAGG - Intergenic
1048160320 8:132014585-132014607 ATGAAAAAGCAGAGGCAAGGTGG + Intergenic
1048661528 8:136608226-136608248 AATAAAAAGGAAAGGCAAGTTGG - Intergenic
1048975931 8:139673051-139673073 AAGGAGAACGAGAGGCAAGAAGG + Intronic
1050104363 9:2150176-2150198 ATGAATAAGCAGAGGCCAACAGG - Intronic
1050690396 9:8221166-8221188 AAGACTAAGGAGAAGCAGGGTGG + Intergenic
1050768185 9:9162600-9162622 GAGAAAATGGAGATGCAAGCAGG - Intronic
1051072396 9:13187451-13187473 AAGAATAAAGATAGGCTATCAGG - Intronic
1051871494 9:21742760-21742782 GAGAATAAGAGGAGTCAAGCTGG + Intergenic
1052077278 9:24158799-24158821 AAGAAGAAGGAAAGGAGAGCAGG - Intergenic
1052473080 9:28924506-28924528 AAGAATAAGGCCAGGCATGGTGG - Intergenic
1054853736 9:69875492-69875514 GATAATAAGGAGAGGCAAAAGGG + Intronic
1055523060 9:77101426-77101448 AAAGACATGGAGAGGCAAGCTGG + Intergenic
1056592157 9:87972509-87972531 GAGAAAAGGGAGAGGCCAGCTGG + Intronic
1056729733 9:89155317-89155339 AAGAGCAAGGAGAGAGAAGCCGG - Intronic
1057750660 9:97790190-97790212 AGGAACAAGGAGAGCGAAGCAGG + Intergenic
1057917990 9:99072218-99072240 AAGTATGAGGAAAGGCAGGCAGG - Intergenic
1058716507 9:107727095-107727117 GAGAAAAAGGAGAGGAAAGAAGG - Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1060437613 9:123607870-123607892 AGGCAGGAGGAGAGGCAAGCGGG + Intronic
1060596286 9:124851076-124851098 AAGAGTAAGGACAGGCAGGCAGG + Intergenic
1061757845 9:132827661-132827683 AAGAATAAGGGGTGTCAAGGGGG + Intronic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185762860 X:2701545-2701567 AAGAATGAGCAGAGGAAACCAGG + Intronic
1186354060 X:8772140-8772162 AAGAACAGGGACAGGAAAGCAGG + Intergenic
1189536689 X:41942455-41942477 AAGAGTAAGAAGAGGCAAATTGG + Intergenic
1192322193 X:70099233-70099255 AAGAATGGGGAGAGGGAAGCTGG + Intergenic
1192471195 X:71400017-71400039 AAGAATAAGGCCAGGCATGGTGG - Intronic
1192703149 X:73497745-73497767 AGGAATCAGGAGAGGCAGTCTGG + Intergenic
1192956655 X:76077947-76077969 AAAGAAAAAGAGAGGCAAGCTGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1194220130 X:91179390-91179412 AAGAATAAGGACAGGCAGACTGG + Intergenic
1194269030 X:91786827-91786849 AAGATAAAAGAGAGGCAAGAAGG - Intronic
1194543520 X:95204436-95204458 AAGAATAATGAAAAGAAAGCAGG - Intergenic
1195142463 X:101976497-101976519 AAAGATAAGGAGTGGCAAGTTGG - Intergenic
1196656247 X:118220498-118220520 AAGCATCAGGAGAGGCAGTCAGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1196799896 X:119532991-119533013 AAGAAAAAGGAAAGGAAAGGAGG + Intergenic
1197707805 X:129646860-129646882 AAGGGAAGGGAGAGGCAAGCTGG - Exonic
1199787695 X:151119443-151119465 AAAAAAAAAGAGAGGCAAGAAGG + Intergenic
1199991632 X:152990562-152990584 AAGAATAAGGAGAAGCCATCAGG - Exonic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200556642 Y:4643147-4643169 AAGAATAAGGACAGGCAGACTGG + Intergenic
1201298448 Y:12485767-12485789 AAGAATAAGGTGAGGAAGGAGGG - Intergenic