ID: 912522822

View in Genome Browser
Species Human (GRCh38)
Location 1:110257990-110258012
Sequence GATTATAAGTAGAACTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912522822_912522827 2 Left 912522822 1:110257990-110258012 CCATCCAAGTTCTACTTATAATC No data
Right 912522827 1:110258015-110258037 TTCGCACTTGCCAGTAAGGGAGG No data
912522822_912522829 27 Left 912522822 1:110257990-110258012 CCATCCAAGTTCTACTTATAATC No data
Right 912522829 1:110258040-110258062 AAGAAATGTTGTCTTTTACCTGG No data
912522822_912522826 -1 Left 912522822 1:110257990-110258012 CCATCCAAGTTCTACTTATAATC No data
Right 912522826 1:110258012-110258034 CCTTTCGCACTTGCCAGTAAGGG 0: 1
1: 0
2: 0
3: 7
4: 56
912522822_912522824 -2 Left 912522822 1:110257990-110258012 CCATCCAAGTTCTACTTATAATC No data
Right 912522824 1:110258011-110258033 TCCTTTCGCACTTGCCAGTAAGG 0: 1
1: 0
2: 1
3: 2
4: 43
912522822_912522830 28 Left 912522822 1:110257990-110258012 CCATCCAAGTTCTACTTATAATC No data
Right 912522830 1:110258041-110258063 AGAAATGTTGTCTTTTACCTGGG 0: 1
1: 0
2: 2
3: 52
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912522822 Original CRISPR GATTATAAGTAGAACTTGGA TGG (reversed) Intronic
No off target data available for this crispr