ID: 912525080

View in Genome Browser
Species Human (GRCh38)
Location 1:110276663-110276685
Sequence TGAGCCTCCTAAGAGATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912525080_912525082 0 Left 912525080 1:110276663-110276685 CCATCAATCTCTTAGGAGGCTCA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 912525082 1:110276686-110276708 TTGGCATGTGTTAGTCCTATAGG 0: 1
1: 0
2: 0
3: 4
4: 103
912525080_912525085 30 Left 912525080 1:110276663-110276685 CCATCAATCTCTTAGGAGGCTCA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 912525085 1:110276716-110276738 AATGCAAGAGCATCATCTTCAGG No data
912525080_912525083 1 Left 912525080 1:110276663-110276685 CCATCAATCTCTTAGGAGGCTCA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 912525083 1:110276687-110276709 TGGCATGTGTTAGTCCTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912525080 Original CRISPR TGAGCCTCCTAAGAGATTGA TGG (reversed) Intronic