ID: 912525082

View in Genome Browser
Species Human (GRCh38)
Location 1:110276686-110276708
Sequence TTGGCATGTGTTAGTCCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912525080_912525082 0 Left 912525080 1:110276663-110276685 CCATCAATCTCTTAGGAGGCTCA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 912525082 1:110276686-110276708 TTGGCATGTGTTAGTCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912525082 Original CRISPR TTGGCATGTGTTAGTCCTAT AGG Intronic
No off target data available for this crispr