ID: 912525082 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:110276686-110276708 |
Sequence | TTGGCATGTGTTAGTCCTAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 108 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 103} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
912525080_912525082 | 0 | Left | 912525080 | 1:110276663-110276685 | CCATCAATCTCTTAGGAGGCTCA | 0: 1 1: 0 2: 0 3: 12 4: 124 |
||
Right | 912525082 | 1:110276686-110276708 | TTGGCATGTGTTAGTCCTATAGG | 0: 1 1: 0 2: 0 3: 4 4: 103 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
912525082 | Original CRISPR | TTGGCATGTGTTAGTCCTAT AGG | Intronic | ||