ID: 912525485

View in Genome Browser
Species Human (GRCh38)
Location 1:110279768-110279790
Sequence CCTAAAGCCCACAGGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912525485_912525489 10 Left 912525485 1:110279768-110279790 CCTGGTTCCCTGTGGGCTTTAGG 0: 1
1: 0
2: 1
3: 12
4: 201
Right 912525489 1:110279801-110279823 TTTTTTTTTTTTTTTTGAGATGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
912525485_912525490 30 Left 912525485 1:110279768-110279790 CCTGGTTCCCTGTGGGCTTTAGG 0: 1
1: 0
2: 1
3: 12
4: 201
Right 912525490 1:110279821-110279843 TGGAGTCTCACTCTGTTGCCCGG 0: 616
1: 2248
2: 6221
3: 10880
4: 14828

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912525485 Original CRISPR CCTAAAGCCCACAGGGAACC AGG (reversed) Intronic
900778321 1:4600860-4600882 ACAAAAGCCCACAAGGAAACTGG + Intergenic
901783636 1:11610463-11610485 ACAAAAGACCCCAGGGAACCTGG - Intergenic
901793757 1:11668589-11668611 CCTCAGGTCCCCAGGGAACCAGG - Intronic
902197148 1:14806139-14806161 CCTAAAGGCCAGAGGAACCCTGG - Intronic
903040619 1:20527216-20527238 CCTCAAGCACACATGGACCCAGG + Intergenic
903562149 1:24236254-24236276 CCCACACCCCACAGGGACCCCGG - Intergenic
903759319 1:25686859-25686881 CCTAAAGGACACAGAGGACCAGG + Intronic
905297180 1:36961583-36961605 CCTGAAGCCCACAGCAAGCCTGG - Intronic
907273773 1:53305777-53305799 CCTCAGCCCCACAGGGAGCCAGG + Intronic
908078545 1:60548074-60548096 CCTGAAGCCAACAGAGAAACAGG + Intergenic
911184298 1:94887853-94887875 CCTCACACCCACAGGGATCCAGG - Intronic
912252305 1:108024275-108024297 AATAAAGCCCACATGGATCCAGG + Intergenic
912267230 1:108170904-108170926 CCTCAAACCCCCAGGGAAACAGG + Intronic
912525485 1:110279768-110279790 CCTAAAGCCCACAGGGAACCAGG - Intronic
913325614 1:117625888-117625910 ACTAAGGCTCACAGGGAAACAGG - Exonic
915653289 1:157335604-157335626 CCCAAAGATCAAAGGGAACCAGG + Intergenic
916787515 1:168097177-168097199 CATGAAGATCACAGGGAACCGGG - Exonic
919787647 1:201270010-201270032 CCTGAAGTCCACAGGCAGCCAGG - Intergenic
923679748 1:236110068-236110090 CCTACAGCCCACTGGTGACCCGG + Intergenic
923997601 1:239512869-239512891 CCCAAAACCCACAGATAACCTGG - Intronic
924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG + Intergenic
1064086911 10:12351796-12351818 CCCAAAGCTCACAGGGAACATGG - Intronic
1065854774 10:29821211-29821233 CCCAATGCCCACAGGGAGGCAGG + Intergenic
1067083537 10:43226601-43226623 CCTGGAACCCACAGGGACCCAGG + Intronic
1067300846 10:45007799-45007821 CTTAAATCCCAGAGAGAACCTGG + Intergenic
1067450117 10:46376911-46376933 ACAAAAGCTCACAGAGAACCTGG - Intronic
1067587126 10:47482852-47482874 ACAAAAGCTCACAGAGAACCTGG + Intronic
1067634185 10:47990619-47990641 ACAAAAGCTCACAGAGAACCTGG + Intergenic
1067735834 10:48849579-48849601 CCTAACCCCCACTGTGAACCTGG - Intronic
1067786537 10:49253549-49253571 CGTAGAGACCACAGGAAACCTGG - Intergenic
1067786592 10:49254763-49254785 TCAAAAGACCACAGGAAACCTGG - Intergenic
1067941695 10:50661860-50661882 CCTAAAGCCAAGAGGTAGCCAGG - Intergenic
1070546116 10:77453906-77453928 CCTCAAGCTCACAGAGCACCTGG + Intronic
1070648687 10:78219474-78219496 ACTGAAGCCCACAGGGGACAAGG - Intergenic
1071475380 10:86020805-86020827 CATCAAACCCACAAGGAACCAGG - Intronic
1074162534 10:110846240-110846262 CTGAAAGCCCCCAGGGAACTAGG + Intergenic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1077220516 11:1413529-1413551 CCTACAGCCCACATGGGCCCTGG + Intronic
1080247312 11:30194395-30194417 CCTATAGCCCACAGAAAACCAGG - Intergenic
1080441294 11:32297200-32297222 CCTAAAGACCATCTGGAACCTGG + Intergenic
1080650829 11:34221588-34221610 CCTCAAGCCCTCAGGGGACTTGG - Intronic
1083325922 11:61872998-61873020 CCTCAAGCCCACCTGGGACCAGG - Intergenic
1083713122 11:64560727-64560749 CCACAAGCACACAGGGACCCAGG + Intronic
1085657231 11:78327584-78327606 TCTAGAGCCTACAGGGAGCCAGG + Intronic
1087509198 11:99068594-99068616 CTTAAAGCCCTTAGGAAACCAGG + Intronic
1091315328 11:134610349-134610371 CCTCCAGCCCTCAGGGAAGCCGG - Intergenic
1094530652 12:31271525-31271547 CCTAAAGCCTCCAGTCAACCTGG - Intergenic
1096475177 12:51905286-51905308 TCCAAAGCACACAGAGAACCTGG - Intergenic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1100227291 12:92572044-92572066 CATGAAGCCCACAGGGACCAGGG + Intergenic
1101724466 12:107377531-107377553 TCTAAGACCCACAGGGATCCAGG - Intronic
1102292744 12:111714349-111714371 TCTAAAGCACACAAGGCACCTGG - Intronic
1102306617 12:111809488-111809510 CCTACAGATCACAGGGAAGCAGG + Intronic
1104785108 12:131444123-131444145 CCTAAAGTCCACAGAAAACCAGG + Intergenic
1104860279 12:131919843-131919865 CCTCAAGGCCACGGGGAGCCAGG + Intronic
1105706589 13:22971201-22971223 CCTAGAGGCCACAGGGAAAATGG - Intergenic
1106862359 13:33923504-33923526 CCTGAAGACCCCTGGGAACCAGG - Intronic
1108465891 13:50715064-50715086 CCGACAGCCCGCAGGGAAGCAGG - Intronic
1109030115 13:57179939-57179961 CCCCAAGAGCACAGGGAACCTGG + Intergenic
1110709689 13:78636610-78636632 CCTAGAGCCCAGAGGGAACCTGG - Intronic
1114485255 14:23057950-23057972 CCAAAAGCCAGCCGGGAACCGGG - Intergenic
1116473318 14:45310474-45310496 CCTAAAGCCCACTGGAAAATGGG + Intergenic
1117444857 14:55794404-55794426 GGTAAAGACCAGAGGGAACCAGG + Intergenic
1119261284 14:73239666-73239688 CCTATGGCCCACAGGTGACCAGG - Intronic
1125987596 15:44070171-44070193 CCTGAAACCCATAGGAAACCAGG + Intronic
1126188653 15:45855784-45855806 CCTGAAGAGCCCAGGGAACCTGG - Intergenic
1129522452 15:76194448-76194470 CCTGAGGGACACAGGGAACCAGG - Intronic
1132163296 15:99563251-99563273 CATAATGCCCACAGTGAATCTGG - Intergenic
1132292623 15:100714026-100714048 CCTTCAGCCAACAGGGTACCAGG + Intergenic
1132650996 16:1021391-1021413 CCCAAGGCCCACGGGGAACTCGG + Intergenic
1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG + Intergenic
1133797521 16:9058207-9058229 ACTAAAGCCCAAAGGGTACAAGG + Intergenic
1135960992 16:26994404-26994426 CCTACTGCCCACTGGGATCCTGG + Intergenic
1136455900 16:30379390-30379412 CCTAAGGCCAGCAGGGAGCCCGG - Intronic
1137862167 16:51857364-51857386 TCTTAACCCCACAGGGAGCCTGG - Intergenic
1138517068 16:57541972-57541994 CCTGAAGCCCAGAGAGGACCTGG - Intergenic
1138599887 16:58047953-58047975 CCAAAAGCCCAGAGGTCACCGGG + Intergenic
1139414371 16:66795363-66795385 GCTTAAGCCCACTGGGAAACTGG - Intronic
1140199318 16:72881746-72881768 CCTAAAGCCGACAGTGTAGCAGG - Intronic
1141519818 16:84571319-84571341 ACTAAGGCCCAGAGGGAGCCCGG - Intronic
1142304102 16:89275932-89275954 CCTCAGGCCCACAGGGAGTCAGG + Intronic
1142871372 17:2823269-2823291 CCAAAACCCCACAGGACACCAGG - Intronic
1146095087 17:29922157-29922179 CCTAAAGACCAAAGGGAGCATGG + Intronic
1147196473 17:38770067-38770089 CTTCAGGCCCACAGGGAAACAGG + Intronic
1148134496 17:45283545-45283567 CCTTAAGGCCACAGGCACCCTGG + Intronic
1149544635 17:57494303-57494325 CCAGAAGCCCACAGTGAACTTGG - Intronic
1150290726 17:63980080-63980102 ACTAAGGCCCAGAGGGGACCAGG + Intergenic
1152878964 17:82804583-82804605 CCAACAGCCCACAAGGCACCGGG - Intronic
1153024665 18:661649-661671 CCTAAAGCCCTCAGGAATCTGGG + Intronic
1153068071 18:1070210-1070232 CCTAGAGCTCACATAGAACCAGG - Intergenic
1155500735 18:26484679-26484701 CCCAAAGAGCACAGGGAACATGG - Intronic
1157454679 18:47815392-47815414 CTGAAAGCCCACAGGGAATGTGG + Exonic
1164944962 19:32285752-32285774 CGTAAAGCCCACAACGAAGCAGG + Intergenic
1165106072 19:33470295-33470317 CCTAAAGGCCACTGGAAACGAGG - Intronic
1167600268 19:50450951-50450973 CCTACAGCCCCCAGGGAAGGAGG - Intronic
1168280723 19:55304117-55304139 CTTAAATCCCACTGGGGACCTGG - Intronic
926280252 2:11440309-11440331 CCTAAGGCCAACAAGGCACCAGG + Intergenic
926296806 2:11574786-11574808 ACTAACACTCACAGGGAACCAGG - Intronic
926887645 2:17612726-17612748 GTTAAAGCCCAGAGGCAACCTGG - Intronic
928233773 2:29522544-29522566 CCTACAGTCAACAGGGACCCAGG - Intronic
929000971 2:37346224-37346246 ACCACAGGCCACAGGGAACCTGG + Intronic
931433413 2:62227937-62227959 GCTCAACCCCACAGGGAATCTGG + Intergenic
931443503 2:62307766-62307788 CCTAGAGCTGACAGGGCACCAGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
936145467 2:109977910-109977932 CATAAAGCCCCCAGGCAACTGGG + Intergenic
936199219 2:110393568-110393590 CATAAAGCCCCCAGGCAACTGGG - Intergenic
936980141 2:118256388-118256410 CCCAATGGGCACAGGGAACCAGG + Intergenic
939334030 2:140802028-140802050 CCTTAAGCTCAGAGGGAACTGGG - Intronic
943722843 2:191223034-191223056 TATAAAGCCTACAGGGAACAAGG + Intergenic
945385888 2:209200637-209200659 CCTAAGAGCCATAGGGAACCTGG - Intergenic
947033252 2:225822116-225822138 TCCAAAGCCCACAGAGGACCTGG - Intergenic
947723366 2:232382083-232382105 CCTACAGCCCAGTGGGTACCAGG + Exonic
947777122 2:232722081-232722103 CAGAGAGCCCACAGGAAACCAGG - Intronic
948408923 2:237743883-237743905 CCAAAATCTCACTGGGAACCTGG + Intronic
948858832 2:240743165-240743187 CCCAGAGGCCACAGGGAACCAGG + Intronic
1170122710 20:12927616-12927638 ACTAAACACCACAGGGGACCAGG + Intergenic
1170614667 20:17939015-17939037 CCTGAAGCCCGCAGGAATCCTGG + Intergenic
1171248489 20:23632099-23632121 CCCACAGCCCACAGGGAAGCAGG - Intronic
1172123007 20:32609529-32609551 CCTAGAGCCCACGGGGAAGTTGG + Intergenic
1172186778 20:33035834-33035856 CCTGAAGTCCCCAGGGAATCTGG + Intronic
1172874926 20:38158408-38158430 CCAAATGACCACAGGGAGCCTGG + Intronic
1173002922 20:39118383-39118405 CTCAAAGCCCACAGTGAACAGGG + Intergenic
1175973134 20:62697194-62697216 CCCAAGGTCCACAGGTAACCAGG - Intergenic
1177068168 21:16465738-16465760 TCCAAAGCTCACAGGGAAGCAGG - Intergenic
1177735188 21:25080356-25080378 CCTGAAAACCACAGGGAGCCTGG - Intergenic
1178804638 21:35828796-35828818 CCTAAAGACAACATGGAAGCTGG + Intronic
1179374612 21:40838921-40838943 CCCAAAGCCCACTTGGAACCAGG + Intronic
1179961668 21:44770903-44770925 CATGGGGCCCACAGGGAACCAGG + Exonic
1183345349 22:37304374-37304396 CCTATGGGCCACAGGGAGCCAGG + Intronic
1183525317 22:38319188-38319210 CCTAATGCCCCCAGAGAAACAGG - Intronic
1183547987 22:38465566-38465588 CCTCAAGACCACAGGGAAACTGG - Intergenic
1184481900 22:44752810-44752832 TCTAGAACCCACAGGGGACCCGG - Intronic
954273053 3:49524330-49524352 CCTAATTTCCACAAGGAACCTGG - Intronic
955393214 3:58536210-58536232 CCTAGAGCACCCAGGGAACGAGG - Intronic
960090183 3:113630827-113630849 CCTGAATCCCACAGGGAGGCAGG + Intergenic
960944373 3:122956254-122956276 CCCAGAACCCACAGGGAACTGGG - Intronic
962148243 3:132864539-132864561 CCTAAAGCACAGAGAGAACAGGG - Intergenic
962326027 3:134433011-134433033 CCTGGAGCCCTCAGGGAACCGGG + Intergenic
964502723 3:157366356-157366378 CCTAAGGGCCAAAGTGAACCTGG + Intronic
967365585 3:188682859-188682881 CCTAATGCACACAGGAAACTAGG + Intronic
967464887 3:189793145-189793167 CCTCGAGCCCAGAGGGAACTAGG + Intronic
967775046 3:193377675-193377697 CCCAGATCTCACAGGGAACCAGG + Intronic
968077449 3:195824362-195824384 CCAAAACCACACAGGGCACCTGG - Intergenic
968077457 3:195824398-195824420 CCAAAACCACACAGGGCACCTGG - Intergenic
968077465 3:195824434-195824456 CCAAAACCACACAGGGCACCTGG - Intergenic
968077473 3:195824470-195824492 CCAAAACCACACAGGGCACCTGG - Intergenic
968077481 3:195824506-195824528 CCAAAACCACACAGGGCACCTGG - Intergenic
968077489 3:195824542-195824564 CCAAAACCACACAGGGCACCTGG - Intergenic
968077497 3:195824578-195824600 CCAAAACCACACAGGGCACCTGG - Intergenic
968077505 3:195824614-195824636 CCAAAACCACACAGGGCACCTGG - Intergenic
968077513 3:195824650-195824672 CCAAAACCACACAGGGCACCTGG - Intergenic
968077521 3:195824686-195824708 CCAAAACCACACAGGGCACCTGG - Intergenic
968077529 3:195824722-195824744 CCAAAACCACACAGGGCACCTGG - Intergenic
968077537 3:195824758-195824780 CCAAAACCACACAGGGCACCTGG - Intergenic
968077545 3:195824794-195824816 CCAAAACCACACAGGGCACCTGG - Intergenic
968077553 3:195824830-195824852 CCAAAACCACACAGGGCACCTGG - Intergenic
968077560 3:195824866-195824888 CCAAAACCACACAGGGCACCTGG - Intergenic
968077568 3:195824902-195824924 CCAAAACCACACAGGGCACCTGG - Intergenic
968122361 3:196134615-196134637 CCCTGACCCCACAGGGAACCCGG - Intergenic
968778532 4:2560946-2560968 CCAAAAGCTCAAAGGGAGCCAGG - Intronic
969327603 4:6452826-6452848 CCCAAAGGCCACAGGGATGCTGG + Intronic
969594521 4:8141427-8141449 CCTGAAGCTCACAGGCACCCAGG + Intronic
971004402 4:22357285-22357307 CCCAAAGCCCAGAGAGGACCTGG + Intronic
973702821 4:53553603-53553625 CCTAGACCCCAAAGGGAATCTGG - Intronic
979025197 4:115562812-115562834 CTTAAAGCCTGCAGGGAAACAGG + Intergenic
981315165 4:143334768-143334790 TCTAAACCCCAGTGGGAACCAGG + Intergenic
981429774 4:144645831-144645853 CCCCAAGCCCGCCGGGAACCCGG + Intergenic
989000400 5:36754221-36754243 CCTAAAGCCATCAAGGAATCTGG - Intergenic
994134134 5:96265467-96265489 CCTAAAGGCCTTAGAGAACCAGG + Intergenic
999499513 5:152132602-152132624 CCAAAATCCCACAGGTACCCCGG + Intergenic
1000884433 5:166735201-166735223 CTTAAAGCCCACAGGCAGGCAGG + Intergenic
1000896061 5:166857012-166857034 CCTCAAGCCCACAAAGAACCTGG + Intergenic
1001544920 5:172565111-172565133 CCTAAAGCCCTCCCGGAGCCAGG - Intergenic
1001589523 5:172855814-172855836 CTCACAGCCCACATGGAACCTGG - Intronic
1001940948 5:175739017-175739039 CCTAAAGCCCTTATGGAATCGGG - Intergenic
1003095639 6:3140977-3140999 CCTAAAGCCCCCAGGCCAGCAGG + Intronic
1006839769 6:37021397-37021419 CTGAAAGCCCACTGGGTACCAGG - Intronic
1009243350 6:61204865-61204887 CCTGAAGCCCACAGAAACCCTGG - Intergenic
1014179324 6:118367506-118367528 CATAAAGCCCACAGCCAAGCTGG + Intergenic
1017616889 6:156255522-156255544 ACTAAATCCCAAAGGGACCCTGG + Intergenic
1018751593 6:166811279-166811301 TCTGAGGCCAACAGGGAACCAGG - Intronic
1018831343 6:167446014-167446036 CTAAAGGCCCACAAGGAACCTGG - Intergenic
1020213013 7:6169619-6169641 CCTTATGCCCACAGTGAAGCGGG - Intronic
1021508687 7:21411948-21411970 CAAGAAGCCCACAGGGAAGCTGG - Intergenic
1022332967 7:29397595-29397617 CTTAAAGGCAACAGGGAACGTGG + Intronic
1023327471 7:39075645-39075667 CCTGAAGGCCACAGGGAGGCTGG + Intronic
1023790317 7:43748770-43748792 ACTAAAGCCAAAAGGGAAGCTGG + Intergenic
1025846180 7:65200295-65200317 CCTAGAGCCCAGAAGGAAGCTGG + Intergenic
1028074695 7:86497418-86497440 CCTAAAAACCACAGGGCACAGGG + Intergenic
1029899692 7:104025749-104025771 CCTAAAGCTCACTTGGAAGCGGG - Intergenic
1030926274 7:115459389-115459411 CCTAAAGCTCACAAGCAACCAGG + Intergenic
1032682591 7:134200965-134200987 CAGACAGCCCACAGGGAAACTGG - Intronic
1042768617 8:72354558-72354580 CTTAAAGCCAACAGGAAACATGG - Intergenic
1043093483 8:75934371-75934393 CCCAAAGCCAACAGGAAACAGGG + Intergenic
1043496793 8:80810148-80810170 CCTCATGCCCACAGGGTACCAGG + Intronic
1045320486 8:101078410-101078432 CCTAACGCCCACTGGGAAGTGGG + Intergenic
1049616973 8:143579868-143579890 CCTACAGCCCACTCGGAGCCAGG + Intronic
1049763871 8:144343874-144343896 CCAAATGCCTTCAGGGAACCTGG - Intergenic
1060739913 9:126091276-126091298 CCTGAAGCTGACAGGGACCCTGG + Intergenic
1061934741 9:133851098-133851120 CCTAAAGCCCGCAGAGCCCCAGG - Intronic
1062287709 9:135780495-135780517 CCAAGAGCCCATAGGGATCCTGG + Intronic
1203792304 EBV:158342-158364 CCTAAAGCCCACCGGGGGCCTGG - Intergenic
1185766115 X:2727189-2727211 CCGAAAACCCACAGGCACCCAGG + Intronic
1186420322 X:9420365-9420387 CCTTAAGCCTCCTGGGAACCTGG - Intergenic
1187132755 X:16518313-16518335 CCTGAAGCCAACATGGAACTGGG - Intergenic
1187410671 X:19048152-19048174 CATAAAGCCCTGAGAGAACCAGG - Intronic
1188252776 X:27919268-27919290 CCTGATGCCAACAGGGAAACAGG + Intergenic
1190063124 X:47223466-47223488 CCTAAAGCCCACAGCCTAGCAGG - Intronic
1192554288 X:72077716-72077738 CCTCCAGCCCAGAGGGATCCGGG + Intergenic
1192562535 X:72136885-72136907 CCTAAAACTTACAGGCAACCTGG + Intronic
1197244227 X:124151566-124151588 TCTAAAGCCCTAAGGGATCCAGG + Intronic
1198268390 X:135032144-135032166 CCTAAAGCCCTCAAGGAGGCCGG - Intergenic
1199683348 X:150242801-150242823 CCTCATGCTCATAGGGAACCAGG + Intergenic
1200041681 X:153375448-153375470 ACTAAAGCCCATAGTGTACCAGG + Intergenic
1200063051 X:153492080-153492102 CCTGAGGCCCTCAGGGATCCTGG - Intronic