ID: 912530465

View in Genome Browser
Species Human (GRCh38)
Location 1:110317308-110317330
Sequence ACTGCCCGGAGCCACCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912530465_912530467 13 Left 912530465 1:110317308-110317330 CCTTGATGGTGGCTCCGGGCAGT No data
Right 912530467 1:110317344-110317366 GTTTTTCTCTCTTTCCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912530465 Original CRISPR ACTGCCCGGAGCCACCATCA AGG (reversed) Intergenic
No off target data available for this crispr