ID: 912532919

View in Genome Browser
Species Human (GRCh38)
Location 1:110339427-110339449
Sequence CTTGGACTCCGCCGCGGCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912532919_912532923 -9 Left 912532919 1:110339427-110339449 CCTGTGCCGCGGCGGAGTCCAAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 912532923 1:110339441-110339463 GAGTCCAAGATGGCGGCGTGCGG 0: 1
1: 0
2: 1
3: 7
4: 94
912532919_912532929 20 Left 912532919 1:110339427-110339449 CCTGTGCCGCGGCGGAGTCCAAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 912532929 1:110339470-110339492 TGTGTGAAACGAGCGCGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 41
912532919_912532925 15 Left 912532919 1:110339427-110339449 CCTGTGCCGCGGCGGAGTCCAAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 912532925 1:110339465-110339487 TCCGCTGTGTGAAACGAGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 64
912532919_912532930 23 Left 912532919 1:110339427-110339449 CCTGTGCCGCGGCGGAGTCCAAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 912532930 1:110339473-110339495 GTGAAACGAGCGCGGGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 98
912532919_912532931 24 Left 912532919 1:110339427-110339449 CCTGTGCCGCGGCGGAGTCCAAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 912532931 1:110339474-110339496 TGAAACGAGCGCGGGGCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 57
912532919_912532928 17 Left 912532919 1:110339427-110339449 CCTGTGCCGCGGCGGAGTCCAAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 912532928 1:110339467-110339489 CGCTGTGTGAAACGAGCGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 16
912532919_912532927 16 Left 912532919 1:110339427-110339449 CCTGTGCCGCGGCGGAGTCCAAG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 912532927 1:110339466-110339488 CCGCTGTGTGAAACGAGCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912532919 Original CRISPR CTTGGACTCCGCCGCGGCAC AGG (reversed) Exonic
906104630 1:43284518-43284540 CTTGGACTCAGCTGTGGCAGTGG - Intronic
912005633 1:104896931-104896953 CTTGGACTCCCCTGTGTCACTGG + Intergenic
912532919 1:110339427-110339449 CTTGGACTCCGCCGCGGCACAGG - Exonic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1077360986 11:2139980-2140002 CCGGGGCTCCGGCGCGGCACCGG - Intronic
1077459857 11:2703653-2703675 CTGGGACACCGCCGGGGCTCTGG - Intronic
1091225939 11:133956537-133956559 CTTGGGCTCCGACGCGGGCCAGG - Intronic
1093894950 12:24564112-24564134 CATGGACTGCGCCGCGTCCCTGG + Intergenic
1094468487 12:30779823-30779845 CTTGGACGCTGCCCCAGCACAGG + Intergenic
1098024663 12:66189259-66189281 CCTGGACTCCGCCTCGTCCCCGG + Exonic
1100186451 12:92145260-92145282 CTTGGGCCCCGCCGCGGGACCGG - Intronic
1113737925 13:112690813-112690835 CTTCGACCCCGCCGGGGCCCGGG + Intronic
1118980164 14:70709941-70709963 CTTGGACTTCGCTGCTGCCCTGG - Intergenic
1122105417 14:99450078-99450100 CTTGGACTCCTCTGTGGCAGAGG - Intronic
1128997543 15:72307750-72307772 CTTGCACTCCCCCGAGGCCCTGG - Intronic
1142328976 16:89438099-89438121 CTTGGACACAGCAGGGGCACTGG + Intronic
1142586853 17:979436-979458 CTCGGGCTCCGCCGCCGCCCCGG + Exonic
1156197878 18:34796443-34796465 CTTGGACTCTGTCGTGGGACAGG - Intronic
1158190964 18:54828433-54828455 CTCGGAGTCCGCCGCGGCGGCGG - Exonic
1159861116 18:73650862-73650884 CTTGGACTCCACCACAGCAGTGG - Intergenic
1161048853 19:2151461-2151483 CTTGGACCCCGCCGCCGCCCTGG - Exonic
1161069262 19:2252305-2252327 CCTGGACTCCGGCGCGGGGCCGG + Exonic
1166863289 19:45821810-45821832 CACAGACTCCACCGCGGCACAGG + Intronic
1167000180 19:46741224-46741246 CTTGGACTAGGCCGGGGCAGTGG + Intronic
930274524 2:49296076-49296098 CTTGGGCTCCTCCGCTGCACAGG - Intergenic
944114316 2:196171180-196171202 CTTGGACTCCGCCGCCCCTGAGG - Intronic
1176005575 20:62860946-62860968 CTTTGCCTCCGCCCCGGCCCCGG + Intronic
1178743708 21:35227050-35227072 TTGGGACTCCTCCCCGGCACAGG + Intronic
1178914468 21:36698992-36699014 CTCCGACCCCGCCGCGGCCCTGG - Intergenic
1180177890 21:46098869-46098891 CTGGGACTCCGCCGGGGCGCTGG + Intronic
1185397561 22:50600672-50600694 CCCGGACTCCGCGGCGGCGCGGG - Exonic
951551516 3:23879669-23879691 CCTGTCCTCCGCCGCGGCCCAGG - Intronic
961501367 3:127338219-127338241 CTGAGACTCCGGCGGGGCACGGG + Intergenic
962307383 3:134300732-134300754 CTGGGACTCCGCCACTCCACAGG + Intergenic
968741347 4:2333175-2333197 CTTGGCCTCCCCCGCAGCACTGG + Intronic
969113372 4:4857075-4857097 CCTGGACTCCGCCGCGGGGGGGG - Intergenic
983576996 4:169270953-169270975 CTCTGACGCCGCGGCGGCACCGG + Exonic
986057259 5:4150531-4150553 CTTGGACTCAGCCACACCACTGG + Intergenic
988184071 5:27836929-27836951 CTCAGACTCCGCAGCGGCGCTGG - Intergenic
1005514142 6:26538434-26538456 CTAGGGCTCCGGCGCGTCACGGG + Exonic
1006586478 6:35118036-35118058 CTTGGCCTCAGCTGCAGCACAGG + Intergenic
1007473313 6:42104513-42104535 CTTGGCCTCCGCGGCGCCCCGGG + Exonic
1011607241 6:89117649-89117671 CTCGGACTACTCCGCGGCCCAGG - Intronic
1013272472 6:108557748-108557770 CGTCGTCTCCGCCGCGGCTCGGG + Intergenic
1017880537 6:158559950-158559972 GTGGGGCTCCGCCCCGGCACGGG + Intronic
1027421176 7:78019555-78019577 CTCGGAGCCCGCCGCCGCACGGG + Exonic
1034447975 7:151123072-151123094 CTTGGACTCCCCCGCCCCTCTGG - Intronic
1035569496 8:662772-662794 CTTGGACACCACTGCAGCACAGG + Intronic
1035848185 8:2887504-2887526 CGTGGACTCAGCCTCGGCAGAGG - Intergenic
1044932089 8:97260390-97260412 CTGGGTCTCCGCCTTGGCACAGG + Intergenic
1048815550 8:138330537-138330559 CCTGGACTCGGCGGCAGCACAGG - Intronic
1049766634 8:144358202-144358224 CTTGGGCTTGGCCGCGGCGCTGG + Exonic
1057587569 9:96343205-96343227 CTTGGCCTCCACCGCTCCACTGG + Intronic
1200108333 X:153726334-153726356 CGTGGACTCAGGCGCGGCAGTGG + Intronic