ID: 912536063

View in Genome Browser
Species Human (GRCh38)
Location 1:110372513-110372535
Sequence GTTTCTTTGGTAGTTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912536060_912536063 24 Left 912536060 1:110372466-110372488 CCTACACCTGCAAGAACTGAGTT 0: 1
1: 0
2: 2
3: 17
4: 155
Right 912536063 1:110372513-110372535 GTTTCTTTGGTAGTTGCTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 208
912536061_912536063 18 Left 912536061 1:110372472-110372494 CCTGCAAGAACTGAGTTGATCTG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 912536063 1:110372513-110372535 GTTTCTTTGGTAGTTGCTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912536063 Original CRISPR GTTTCTTTGGTAGTTGCTGC TGG Intronic
903971438 1:27121564-27121586 GTCTCTAAGGCAGTTGCTGCTGG - Intronic
904946485 1:34202583-34202605 GTCTCTTTGCTAGTTGTGGCTGG + Intronic
906472220 1:46140697-46140719 GTTTCTTTCTTAGTTTCTGGGGG - Intronic
909040406 1:70642786-70642808 GTTTCTTGGGTAGATGCTACAGG - Intergenic
909339466 1:74515508-74515530 GTTTCTCTGATGGTTGCTGTTGG + Intronic
909694417 1:78450002-78450024 GTTTCTTTGGCAGTGTCTCCAGG + Intronic
909898878 1:81108858-81108880 ATTTCTTTGGTAGGTGTTCCAGG + Intergenic
910365271 1:86458768-86458790 ATTTCTTTGGTATTTCTTGCTGG - Intergenic
911619952 1:100055353-100055375 TTTTTTTTTGTAGTTGCTTCTGG + Intronic
912194361 1:107379973-107379995 GTTTCTTTGAGAGTTGCTCCTGG + Intronic
912536063 1:110372513-110372535 GTTTCTTTGGTAGTTGCTGCTGG + Intronic
915305969 1:154978744-154978766 GTTTCTTGGGTAGTGGGCGCCGG - Exonic
915566604 1:156717334-156717356 GTTTTTTTGGAAGATGATGCTGG - Intergenic
917855413 1:179095329-179095351 GTGTGTTTGTTAGTGGCTGCTGG - Exonic
918487748 1:185046331-185046353 GTGTCTTGGTTAGTTTCTGCGGG + Intronic
921343671 1:214159590-214159612 CTTTCTCAGGTAGTTGCTGGAGG + Intergenic
922122537 1:222686845-222686867 CTTTCTTTGGTATTTGCTAGTGG - Intronic
923009427 1:230076425-230076447 TGATCTTTGGGAGTTGCTGCGGG + Intronic
1063394318 10:5672398-5672420 GTTTCTTTCTTAGTGGCTGGAGG - Intergenic
1064259257 10:13771708-13771730 GTTTCTTTGGTTATCACTGCTGG + Intronic
1064976154 10:21118112-21118134 TTTTCATTGGTAGTGGCTGTGGG - Intronic
1065059618 10:21886180-21886202 GTTTCTGTAGTAGTTTCTGTTGG - Intronic
1065205959 10:23357925-23357947 GTTTCTTGGGTTTTTGCCGCTGG - Intergenic
1065840693 10:29698141-29698163 GTTTCTTGGGTAGTGGGCGCCGG - Intronic
1066215491 10:33282542-33282564 GGTTCTATGGTAGTTACTGGGGG - Intronic
1068466942 10:57406290-57406312 TCTTCATTGGTAGTTGCTCCTGG + Intergenic
1068877682 10:62014454-62014476 GTTCCTTGGGTAGTTGCAGATGG + Intronic
1069426512 10:68293191-68293213 GACTCTATGGTTGTTGCTGCTGG - Intronic
1070781347 10:79139222-79139244 GTGGCTTTGGAAGTGGCTGCCGG + Intronic
1070814802 10:79316195-79316217 GTTTCTGTGGGAGTTACTTCAGG - Exonic
1071384144 10:85102694-85102716 GTTTCTTTGGTAGTTCCATGTGG - Intergenic
1072690073 10:97566966-97566988 TTTTCTTTGTCAGATGCTGCAGG + Intronic
1076596406 10:131625313-131625335 GTTTCTGTGGTAGCAGCGGCAGG - Intergenic
1077913257 11:6592862-6592884 GCTGTTTTGGTTGTTGCTGCTGG - Intronic
1082183392 11:49147813-49147835 GCTTCTTTGGAGGCTGCTGCAGG + Intronic
1082227092 11:49720943-49720965 GTTTCTTTTGTTGTTGTTGTTGG - Intergenic
1085048634 11:73368045-73368067 GTGTCTTTGGTAGAAGCTCCAGG - Exonic
1088382717 11:109214038-109214060 GTTTCCTTAGTAGTTGCTATAGG + Intergenic
1092050438 12:5465886-5465908 GTTTCTTGGGTAGCTACTCCTGG - Intronic
1093092979 12:14942131-14942153 GATTCTTTTGTGGTTGTTGCTGG - Exonic
1093184209 12:16001380-16001402 TTTTCTTTGGTTGTTCCTTCAGG + Intronic
1094390921 12:29949590-29949612 TTTTCTTTTGTTGGTGCTGCAGG + Intergenic
1094784216 12:33827297-33827319 GTTTATTTAGTAATTGCTGTAGG - Intergenic
1095282532 12:40372132-40372154 GGATCTTTGGAAGTTGCTCCTGG + Intergenic
1095862268 12:46930822-46930844 GTTTCTTTAGTTGTTGGTGCAGG - Intergenic
1100614930 12:96223593-96223615 GTTCCTGTTGCAGTTGCTGCTGG + Exonic
1102359285 12:112269759-112269781 GCTTCTTTGGCAGTTGTTGATGG - Exonic
1102686576 12:114729428-114729450 GTTTCTCTGGGAGTGGCTGGAGG + Intergenic
1106469636 13:30042967-30042989 CCTTCTTAGGTAGTTCCTGCTGG - Intergenic
1107366970 13:39690673-39690695 GTTTTTTTGGTATATGCTTCAGG + Intronic
1107812068 13:44210059-44210081 GCTTCTTTGGAAGTTGAGGCAGG + Intergenic
1107869142 13:44731018-44731040 GACTCTCTGGTAGTTGCTGTTGG - Intergenic
1108715248 13:53072245-53072267 GATTGATTGGTAGTTGATGCTGG + Intergenic
1109289086 13:60451326-60451348 GTTTCTGGAGTAGTGGCTGCAGG + Intronic
1111075200 13:83226373-83226395 TTTGGTTTGGTTGTTGCTGCAGG - Intergenic
1114761066 14:25315092-25315114 GTTTGTTTGCTTGTTGCTGGTGG - Intergenic
1116536753 14:46041366-46041388 GTTCCTTTGGTAGCTGCAGGTGG + Intergenic
1119569255 14:75655544-75655566 GTTTCTTTGGTGTTTGCTGGGGG + Intronic
1121473117 14:94172202-94172224 GATTGTTTGGTGGGTGCTGCTGG + Intronic
1124825546 15:33091052-33091074 TTTTCTTTTGAAGTAGCTGCTGG + Intronic
1131534960 15:93229122-93229144 GTTTTTTTGGTTGTTGCTCTAGG + Intergenic
1131959901 15:97778636-97778658 GTTTCTGTTGTAGTTGCTTTTGG - Intergenic
1132206950 15:99992891-99992913 GGGTCTTGGGTAGTTGCAGCGGG + Intronic
1132352657 15:101149364-101149386 GTTTCTGTGCTTGTTGCTGTGGG - Intergenic
1133636021 16:7666371-7666393 TTTTCTTGGGTAGGTGTTGCTGG - Intronic
1134226424 16:12394622-12394644 ATTTATCTGGTAGTTGGTGCTGG + Intronic
1136121606 16:28139725-28139747 GTTTTTTTGGTGGTTGCTCTGGG - Intronic
1137381997 16:48008084-48008106 GTTTTTTTTGTTGTTGTTGCTGG - Intergenic
1137850815 16:51740573-51740595 GTTTGTTTGTTTTTTGCTGCAGG - Intergenic
1138142103 16:54577750-54577772 GTTTCTTAGAAAGTTCCTGCCGG - Intergenic
1140763041 16:78129172-78129194 GTTTCTTTTTTATTTCCTGCTGG + Intronic
1144094979 17:11892213-11892235 GATTGATTGGTAGTGGCTGCTGG - Intronic
1146635118 17:34498233-34498255 GTTTCTTGGCAAGTTGCTCCTGG + Intergenic
1148255452 17:46127453-46127475 GTTTCTTTTTTTGTTGTTGCCGG - Intronic
1150479098 17:65496075-65496097 GTTTGTTTGTTTGTTTCTGCTGG + Intergenic
1155269691 18:24127829-24127851 GTTTGTTTTCTAGGTGCTGCAGG + Intronic
1156334272 18:36154269-36154291 GTTTATATGGTTGTTGTTGCAGG + Intronic
1156911975 18:42421934-42421956 GTCTCTTTGGTAAATGATGCTGG - Intergenic
1158730708 18:60019521-60019543 GTTTATTTTGTGGTTGCTGACGG + Intergenic
1159683078 18:71379618-71379640 GGTTCTTTGGTAGGTGAGGCAGG + Intergenic
1160061532 18:75533359-75533381 GTTTCTTTTCTATTTCCTGCTGG - Intergenic
1161648971 19:5472554-5472576 ATTTCTTTGAAAGATGCTGCAGG + Intergenic
1163704271 19:18803279-18803301 GTTTCTTTCCAAATTGCTGCTGG + Intergenic
1165983095 19:39742360-39742382 GTTTCTCAGTTAGTTGCTGTTGG + Intergenic
1167772573 19:51530444-51530466 GTTTCCTTGGAAGATGCTGATGG + Exonic
925323485 2:2996576-2996598 CTTTCTTTGGAAGCTGCTGGAGG + Intergenic
925624149 2:5825594-5825616 GATTCTTTGGTAGAGGCTGGAGG - Intergenic
927000925 2:18793575-18793597 GTTTCTTTGGTGGCTGCACCTGG + Intergenic
927047746 2:19297004-19297026 GGATCTTTGGTAGTTTCTGAAGG + Intergenic
929288867 2:40166222-40166244 GTTGCTTTGGCAGCTGTTGCAGG + Intronic
930871869 2:56179058-56179080 GTATCTTTGCAAGTTACTGCTGG - Intergenic
931660166 2:64553344-64553366 GCTCCTTTGGAAGTTGCTGAAGG - Exonic
932939256 2:76142723-76142745 GTCACTATGGTAGTTGCTGCAGG + Intergenic
933054185 2:77641873-77641895 TTTTCATTGGTATCTGCTGCTGG + Intergenic
935127930 2:100240436-100240458 GTTTCTTAGGAAGGTGGTGCAGG - Intergenic
936501537 2:113070558-113070580 GCTTCTTTGGTTGTAGCAGCAGG - Intronic
937481170 2:122261052-122261074 GTTTCTGTTAAAGTTGCTGCAGG + Intergenic
938926274 2:136045665-136045687 GTTTCTTTTGGATTTTCTGCTGG + Intergenic
939532860 2:143386810-143386832 GTTTCTTTTGTTGTTGTTGTTGG + Intronic
940545928 2:155085249-155085271 GTTTTTGTTGTAGTTGCTTCAGG + Intergenic
942508538 2:176670463-176670485 GTAGTTTTGGTAGATGCTGCTGG + Intergenic
944168271 2:196746536-196746558 ATTTCTCTGGTAGTTGCTTGAGG + Intronic
944694065 2:202185336-202185358 GCTACTTTGGTAGTGGCAGCTGG + Intronic
944828719 2:203511162-203511184 ATTTCTGTGGTAGTTGCTCTGGG - Intronic
946752693 2:222908314-222908336 GATTATTTGGCAGTGGCTGCTGG + Intronic
947083435 2:226423999-226424021 ATTTCTGTGTTACTTGCTGCAGG - Intergenic
947133800 2:226956370-226956392 GTGTCTTTAGTAATAGCTGCAGG + Intronic
947608579 2:231507240-231507262 GTTTCTTTGATAGGTTCTGTGGG + Intergenic
947705736 2:232273999-232274021 GGTTCTGTGTTAGCTGCTGCTGG + Intronic
948289904 2:236817090-236817112 GTTTCTTTGGCATTTGTTGTGGG + Intergenic
948499460 2:238381309-238381331 GTTTCTTTGGGACTTGCAGATGG + Intronic
1172245385 20:33442453-33442475 GTTGCTTTGGGAGTATCTGCTGG + Intronic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1173218281 20:41108747-41108769 GTTTCTTTGGTTGAAACTGCAGG - Intronic
1173296535 20:41764183-41764205 GGTTCTCTGGTAGTTGAGGCAGG + Intergenic
1173639102 20:44586807-44586829 GTTTCTTTGGAAGTTGCCGTGGG + Intronic
1174034705 20:47661552-47661574 GTTTCCTGGGCAGTTGGTGCAGG + Intronic
1174754609 20:53145450-53145472 CTTTCTTTGGTTGTTGATCCTGG + Intronic
1175635823 20:60582165-60582187 CTTCCTTTGGTGGTGGCTGCTGG - Intergenic
1177436676 21:21063734-21063756 GTTTCTTTGGTATTTATTACTGG + Intronic
1178004910 21:28207335-28207357 CTTTCTTTTGTATTTGATGCAGG - Intergenic
1183763333 22:39846078-39846100 GTTTCTTTGATAAGTGGTGCTGG + Intronic
949913915 3:8941556-8941578 GTCTCTTTGGTCTTTGCAGCAGG + Exonic
950263382 3:11558285-11558307 GTTTCTTTGGTAACTGAGGCAGG + Intronic
950446535 3:13042006-13042028 GTTTCATTGTTCCTTGCTGCCGG - Intronic
951840006 3:27024116-27024138 GTAGCTTTAGTAGATGCTGCTGG - Intergenic
952503901 3:33989801-33989823 GATACTTTGGTTGTTGGTGCAGG + Intergenic
953822010 3:46214923-46214945 GTTTCTGGGGTGGTTCCTGCTGG + Intronic
954541108 3:51393342-51393364 GTTGCTGAGGGAGTTGCTGCTGG - Exonic
957386903 3:79507670-79507692 GTTTCTGTGGTATATGCTGGCGG + Intronic
958418111 3:93900971-93900993 GGTTCTTTGGTAGTGTCTGCTGG - Intronic
958445128 3:94205623-94205645 GATTCTCTGTTAGTTGCTTCAGG + Intergenic
958802310 3:98770448-98770470 GTTTCTGTGGTGTTCGCTGCCGG + Intronic
958983063 3:100747433-100747455 GTTTCATTGCAAGTAGCTGCAGG + Intronic
962853216 3:139323340-139323362 GTTTCTTGGGTGATTGTTGCGGG + Intronic
965676131 3:171198785-171198807 GTTTCTTTGGTCCATCCTGCTGG - Intronic
965681701 3:171258536-171258558 GTTCCTTATGTAGTTGCTACAGG - Intronic
965824742 3:172719245-172719267 GTTTTTTTTGTTGTTGCTGTTGG + Intergenic
966457280 3:180131857-180131879 GTTTCTTTAGTAGTTACTAATGG + Intergenic
971814660 4:31471752-31471774 GTTTTTTATGTAGTTGCTGTAGG - Intergenic
975863770 4:78704771-78704793 CTTTCTTGGGTATATGCTGCTGG - Intergenic
975946780 4:79716005-79716027 GTTTCTTTGTTATTTTCTGTTGG - Intergenic
980734199 4:136863316-136863338 GTATCTTTGTTAGTAGCTGATGG - Intergenic
981866590 4:149427780-149427802 TTTTCTTTGGTAGTTGCAAATGG - Intergenic
982183987 4:152778098-152778120 GTTTCCTTGGCAGCTGCTGATGG - Intronic
982896154 4:160929566-160929588 GCTTCTTTTGTAATTGCTGGAGG + Intergenic
984492129 4:180447749-180447771 ATTGCATTGATAGTTGCTGCTGG - Intergenic
985130614 4:186734939-186734961 GTGTCTTTTATAGTTGCTGAGGG - Intergenic
987403189 5:17498796-17498818 GATTTTTTTGTAGTTGCTGTTGG - Intergenic
987405371 5:17518932-17518954 GATTCTTTTGCAGTTGCTGTTGG - Intergenic
987405818 5:17522366-17522388 GATTCTTTTGCAGTTGCTGTTGG - Intergenic
987406265 5:17525800-17525822 GATTCTTTTGCAGTTGCTGTTGG - Intergenic
987406711 5:17529234-17529256 GATTCTTTTGCAGTTGCTGTTGG - Intergenic
987407434 5:17585171-17585193 GATTCTTTTGCAGTTGCTGTTGG + Intergenic
987408135 5:17590373-17590395 GATTCTTTTGCAGTTGCTGTTGG + Intergenic
987409036 5:17597241-17597263 GATTCTTTTGCAGTTGCTGTTGG + Intergenic
987410030 5:17605346-17605368 GATTTTTTTGTAGTTGCTGTTGG - Intergenic
987412958 5:17632653-17632675 GACTCTTTTGTAGTTGCTGTTGG - Intergenic
987414613 5:17649610-17649632 TTTTTTTTTGTAGTTGCTGTTGG - Intergenic
987562911 5:19547387-19547409 GCTTTTCTGATAGTTGCTGCAGG - Intronic
990653534 5:57929269-57929291 CTTACTTTGGTTGTTTCTGCAGG - Intergenic
991073423 5:62512254-62512276 GTTTCTTGGGTAGTGGGCGCCGG + Intronic
991653968 5:68884303-68884325 GTTTCTGTTGTGGTTGCTGCGGG + Intergenic
992895921 5:81245154-81245176 GGTTTTTTGGCAGCTGCTGCAGG + Intronic
993695785 5:91060175-91060197 GTTTGTTTGTTTGTTGCTGGGGG + Intronic
994041691 5:95266068-95266090 GTCTCTTTGGTAAATGCTGCAGG + Intronic
994932629 5:106208232-106208254 GTTTCTTGGGAAGCTGATGCAGG - Intergenic
995000943 5:107129022-107129044 GTTTCAATGGTTGTTTCTGCAGG + Intergenic
995096004 5:108236524-108236546 GTTTTTTTGGTTGTTGTTGTTGG - Intronic
996595100 5:125191734-125191756 GTTTCTTTCGTAGTTTCCTCAGG + Intergenic
999189529 5:149736604-149736626 ATCTCTTTGGTAGTAACTGCAGG - Intronic
1003051512 6:2784994-2785016 GTGTCATTGGTAGGTGCTTCTGG + Exonic
1003440284 6:6134537-6134559 GGTTCTTTGCTAGCTGCTGGTGG - Intergenic
1003675576 6:8201505-8201527 TTTCCTTGGCTAGTTGCTGCAGG + Intergenic
1005911041 6:30309824-30309846 ATTTCTTTGCTATTTGCTGTTGG - Intergenic
1007090710 6:39183141-39183163 GATTCTTGGGTAGTCCCTGCAGG + Intergenic
1007237130 6:40398739-40398761 GTTTCTTTGGTAAGTGCTTGGGG - Intronic
1009408286 6:63335180-63335202 GTCTCTTTGATAGTTGGTGCTGG + Intergenic
1014313769 6:119837831-119837853 CTTTCTTTGGAGGTTGCTTCAGG + Intergenic
1014653036 6:124064874-124064896 GTGACTTTGGTTGTTCCTGCTGG + Intronic
1014750979 6:125255883-125255905 GTTTCTTTAGTAGGAGCTGGTGG + Intronic
1015577734 6:134690613-134690635 GTTACAGTGGTGGTTGCTGCAGG + Intergenic
1015695544 6:135976054-135976076 GTTTCTGTGGTATCGGCTGCAGG - Intronic
1018035449 6:159877532-159877554 CTTTATTTGGAAGTTGTTGCAGG + Intergenic
1018073612 6:160189661-160189683 GTTTTTCTTGTCGTTGCTGCTGG - Intronic
1018970698 6:168526654-168526676 GTTTATTTCTTAGTTGGTGCAGG + Intronic
1020340214 7:7101856-7101878 GAATCTTTGGTTTTTGCTGCTGG + Intergenic
1020521819 7:9199480-9199502 GTGTCTTTTGTTGTTGTTGCTGG + Intergenic
1024376833 7:48649270-48649292 GTTTCTTTAGTAGTGACTGCTGG - Intergenic
1026579738 7:71605068-71605090 GTTTCACTGGTAGTTTCTGAAGG - Intronic
1026843373 7:73683366-73683388 GTTACCTTGGAGGTTGCTGCAGG - Exonic
1027685046 7:81268948-81268970 GTTTCTTTGGTTGTTATTGGTGG - Intergenic
1028008157 7:85604957-85604979 GTATCTTTGGTAAATGGTGCTGG - Intergenic
1029356138 7:100053198-100053220 GTTTCCTTGGATGTTGCTGCTGG - Intronic
1031287095 7:119884447-119884469 GTTTCTTTAGTAAATGGTGCTGG - Intergenic
1031309491 7:120177730-120177752 GTTTGTTTAGAAGGTGCTGCAGG - Intergenic
1031537913 7:122958038-122958060 GTTTCTCTAGTAGGAGCTGCAGG + Intergenic
1033037355 7:137887256-137887278 GTTTCATTGGTACTAGCTGGGGG - Intronic
1033501187 7:141951258-141951280 GTTTCTTTGGAGGTTACTGAAGG - Intronic
1036164505 8:6420025-6420047 GTTTCTTTTATAGGTGATGCTGG + Intronic
1036758459 8:11488787-11488809 TTTTCCTTAGTAGTTGCTGCAGG + Intergenic
1038996923 8:32933730-32933752 GGTTCTATGGTAATGGCTGCTGG - Intergenic
1044749712 8:95404338-95404360 GTTTATTTTGTAGTTGCTACTGG - Intergenic
1044958958 8:97510888-97510910 GTATGTCTGGTAGTTGATGCTGG - Intergenic
1047245349 8:123138237-123138259 CTGTCATTGGTAGTGGCTGCTGG + Intronic
1047916519 8:129589742-129589764 ATTTCTTTGCCAGGTGCTGCAGG - Intergenic
1050623098 9:7475150-7475172 GTGTCTTTTGTAGATGCTGTAGG + Intergenic
1053628328 9:39901006-39901028 GTTTCTTTGGAAGGTGCTTTTGG + Intergenic
1054215559 9:62349695-62349717 GTTTCTTTGGAAGGTGCTTTTGG - Intergenic
1054364323 9:64317103-64317125 GTTTCTTTGGAAGGTGCTTTTGG + Intergenic
1054671922 9:67805652-67805674 GTTTCTTTGGAAGGTGCTTTTGG + Intergenic
1054970682 9:71082207-71082229 TTTTCCTTGGTAGTTACTGAAGG + Intronic
1059261124 9:112977816-112977838 CTTTCTTGGGAAGTTGCTGGAGG + Intergenic
1059764888 9:117374786-117374808 TTTCCTTTGGTAGGTGCTCCTGG - Intronic
1189702719 X:43728381-43728403 GTGTCTTTAATAGTTGCTTCAGG + Intronic
1190429263 X:50363271-50363293 ATTTTTTTAGTAGTTGCTCCAGG - Intergenic
1192458492 X:71297678-71297700 GTTTCTTTGGGGGTTGCCTCAGG + Intronic
1193334757 X:80274725-80274747 GTTTTTTTGGTCTTTGATGCTGG - Intergenic
1194055489 X:89127128-89127150 GTTACTTGGGGAGTTGCTGTGGG + Intergenic
1194220805 X:91188032-91188054 TTTTCTTTAGCAGTTGCTCCAGG - Intergenic
1199499182 X:148490845-148490867 GTTTCTTTGATAAATGGTGCGGG - Intergenic
1199560445 X:149157332-149157354 GTTTCTTTAGTGGTTGCTTTAGG + Intergenic
1200557311 Y:4651773-4651795 TTTTCTTTAGCAGTTGCTCCAGG - Intergenic