ID: 912537326

View in Genome Browser
Species Human (GRCh38)
Location 1:110384577-110384599
Sequence GTTCCCCTCTAGACCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912537326_912537332 12 Left 912537326 1:110384577-110384599 CCCACAGGGGTCTAGAGGGGAAC No data
Right 912537332 1:110384612-110384634 TGCATTCACTCGTAAAGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912537326 Original CRISPR GTTCCCCTCTAGACCCCTGT GGG (reversed) Intronic
No off target data available for this crispr