ID: 912537332

View in Genome Browser
Species Human (GRCh38)
Location 1:110384612-110384634
Sequence TGCATTCACTCGTAAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912537326_912537332 12 Left 912537326 1:110384577-110384599 CCCACAGGGGTCTAGAGGGGAAC No data
Right 912537332 1:110384612-110384634 TGCATTCACTCGTAAAGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 61
912537330_912537332 -10 Left 912537330 1:110384599-110384621 CCTAGCCAGGGTTTGCATTCACT 0: 1
1: 0
2: 0
3: 13
4: 182
Right 912537332 1:110384612-110384634 TGCATTCACTCGTAAAGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 61
912537327_912537332 11 Left 912537327 1:110384578-110384600 CCACAGGGGTCTAGAGGGGAACC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 912537332 1:110384612-110384634 TGCATTCACTCGTAAAGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912537332 Original CRISPR TGCATTCACTCGTAAAGCCC AGG Intronic