ID: 912538074

View in Genome Browser
Species Human (GRCh38)
Location 1:110390814-110390836
Sequence GTTGGTTTTCTAACAACGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 49}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912538074_912538080 16 Left 912538074 1:110390814-110390836 CCAGTCGTTGTTAGAAAACCAAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 912538080 1:110390853-110390875 TTCCCATCTTACCTTTGATGTGG 0: 1
1: 0
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912538074 Original CRISPR GTTGGTTTTCTAACAACGAC TGG (reversed) Intronic
901329411 1:8393534-8393556 GTTGGTTTTCTAACAGCTCAAGG + Intronic
904415217 1:30356964-30356986 GTTGGTTGTCCAACCACAACAGG + Intergenic
907876659 1:58495525-58495547 TGTGGTTTTCTAACAATGGCAGG + Intronic
909774741 1:79469318-79469340 GTTGGTTTATGAACAACAACAGG - Intergenic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
920008175 1:202848697-202848719 GTTGGATTTCTAATAGGGACCGG + Intergenic
923967535 1:239158038-239158060 ATTGTTTTTCTAACAACAAATGG + Intergenic
1092005459 12:5065872-5065894 GTTGGTTTCCAAATACCGACTGG - Intergenic
1102359701 12:112274220-112274242 GTTCATTTTCTAACAATAACAGG + Intronic
1107282424 13:38751804-38751826 TTTTTTTTTCTAACAAGGACTGG + Intronic
1109104219 13:58229352-58229374 GTTGGTTTCATAACAACATCTGG - Intergenic
1110599280 13:77353286-77353308 TTTGCTTTTCTAACTACCACTGG + Intergenic
1119538752 14:75424986-75425008 TTTGTTTTTCTAAAAAAGACAGG - Intergenic
1120168411 14:81224710-81224732 TTTGATTTTCCAACAACGATAGG - Intergenic
1121402286 14:93690413-93690435 GTTGTGTTTCTAACATCCACAGG - Intronic
1126244380 15:46487008-46487030 ATTGTTTTTCAAACAATGACAGG + Intergenic
1126742889 15:51796050-51796072 GTTGGTTTTCTTAAAATGTCTGG + Intronic
1129142695 15:73614957-73614979 GTTTGTTTTCTAACAAGCAAGGG + Intronic
1148677824 17:49455362-49455384 GTTGGATTTCCAACAACATCTGG - Intronic
1149881108 17:60291744-60291766 GTTGGTTTTATACCAACTAGAGG + Intronic
1152822202 17:82443080-82443102 GTTAGTTTTTTTACAAAGACAGG + Exonic
1153420962 18:4904648-4904670 TTTGATTTTCTAAAAAGGACTGG - Intergenic
1155404200 18:25469664-25469686 CTTGGCTTTCTAACACTGACTGG - Intergenic
927383248 2:22503081-22503103 GTTAGTTTTCTATCAACTCCTGG - Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
935005310 2:99068804-99068826 GTTGGTATACTCAGAACGACAGG - Intronic
948561493 2:238856793-238856815 GTTGTTTTTCTGAGAACGGCAGG - Intronic
1173823536 20:46033135-46033157 ATTGGTTTTATAACAGAGACAGG + Intronic
1180832729 22:18914155-18914177 GTTGCTTTTCTAAAAGCAACTGG + Intronic
1203282814 22_KI270734v1_random:139460-139482 GTTGCTTTTCTAAAAGCAACTGG + Intergenic
951187487 3:19730606-19730628 GTTTGTTTTCCTATAACGACTGG - Intergenic
957175640 3:76804406-76804428 GTCGGTTTTCTAACAAGGATAGG + Intronic
957392556 3:79595919-79595941 GTTGTTTATCTCACAAGGACAGG - Intronic
960132123 3:114068381-114068403 GTTGGATTTTTAACAACTTCAGG + Intronic
960321706 3:116244692-116244714 GTTTGTTTTCTAATAAGGAGGGG - Intronic
961958521 3:130829342-130829364 ATTTGTTTTCTAACAAAGAGCGG + Intergenic
966517246 3:180831429-180831451 GTTGTTTTTCTTGAAACGACAGG - Intronic
972917628 4:43901005-43901027 GTTGGCTTTCTAAGAATCACAGG - Intergenic
974800895 4:66816485-66816507 GTTGTTTTTCTTATAATGACAGG + Intergenic
975887779 4:78985625-78985647 TTTGTCTTTCTAACAACGAGAGG - Intergenic
988490534 5:31701591-31701613 GTGGGTTTTCTAAATAAGACAGG - Intronic
991271168 5:64783246-64783268 GGTGGTTTTCTCACCATGACAGG - Intronic
993795055 5:92256710-92256732 TTTGGTTTTGCCACAACGACTGG + Intergenic
1000600305 5:163265878-163265900 TTTGGGATTCTAACAACGAGGGG + Intergenic
1003619851 6:7690182-7690204 GTTGGAATTCTAACAACAAAAGG - Intergenic
1010243056 6:73634857-73634879 GTTGGTTTTCTAACAACTAATGG + Intronic
1013400036 6:109784904-109784926 GTTGGTTTTCTAAAATTTACTGG - Intronic
1028386707 7:90262578-90262600 GTTGGTTCTCTAACAAGTTCTGG + Intronic
1031206541 7:118765166-118765188 GTTTGTTTTCAAACAATGAAAGG - Intergenic
1045219139 8:100179968-100179990 GTTGTTTTTCTTAAAGCGACAGG - Intronic
1048261019 8:132945050-132945072 GTTTTTATTCTAATAACGACTGG + Intronic
1189546205 X:42045176-42045198 GTTTGTTTCCCGACAACGACAGG - Intergenic