ID: 912538080

View in Genome Browser
Species Human (GRCh38)
Location 1:110390853-110390875
Sequence TTCCCATCTTACCTTTGATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912538074_912538080 16 Left 912538074 1:110390814-110390836 CCAGTCGTTGTTAGAAAACCAAC 0: 1
1: 0
2: 1
3: 1
4: 49
Right 912538080 1:110390853-110390875 TTCCCATCTTACCTTTGATGTGG 0: 1
1: 0
2: 1
3: 10
4: 145
912538075_912538080 -2 Left 912538075 1:110390832-110390854 CCAACCCAGCACACAGTCCCATT 0: 1
1: 0
2: 1
3: 19
4: 277
Right 912538080 1:110390853-110390875 TTCCCATCTTACCTTTGATGTGG 0: 1
1: 0
2: 1
3: 10
4: 145
912538076_912538080 -6 Left 912538076 1:110390836-110390858 CCCAGCACACAGTCCCATTCCCA 0: 1
1: 0
2: 1
3: 30
4: 353
Right 912538080 1:110390853-110390875 TTCCCATCTTACCTTTGATGTGG 0: 1
1: 0
2: 1
3: 10
4: 145
912538077_912538080 -7 Left 912538077 1:110390837-110390859 CCAGCACACAGTCCCATTCCCAT 0: 1
1: 0
2: 3
3: 21
4: 229
Right 912538080 1:110390853-110390875 TTCCCATCTTACCTTTGATGTGG 0: 1
1: 0
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912538080 Original CRISPR TTCCCATCTTACCTTTGATG TGG Exonic
900811256 1:4802978-4803000 TTTCCATTTTTCCCTTGATGGGG + Intergenic
905140027 1:35835983-35836005 TCAGAATCTTACCTTTGATGAGG - Exonic
905161020 1:36034323-36034345 AGCATATCTTACCTTTGATGAGG - Exonic
905850230 1:41268495-41268517 TTCCCATTTATCCTTTGGTGGGG - Intergenic
906699664 1:47848761-47848783 TTCCCATTATTCCTTTGCTGTGG - Intronic
907673158 1:56494358-56494380 TTCTCAGCCTTCCTTTGATGTGG + Intergenic
908556653 1:65263184-65263206 TTCCCATCTTTCCTTGGCAGTGG - Intronic
908657174 1:66400636-66400658 TTCCCAGATTTCCTTTGATTTGG - Intergenic
910360477 1:86410399-86410421 GTTCCATCCTACCTTTGGTGTGG + Intergenic
911513542 1:98838720-98838742 TTCCCCTCTTACCATTGGTTAGG + Intergenic
912538080 1:110390853-110390875 TTCCCATCTTACCTTTGATGTGG + Exonic
916849191 1:168685430-168685452 CCCCCATCTTACCATTGAGGGGG - Intergenic
917063243 1:171063877-171063899 TTCCCATTTTTCTTTTAATGGGG + Intronic
917625615 1:176843132-176843154 TTCCCATCTTTCTATGGATGCGG + Exonic
918674101 1:187259995-187260017 ATCCCATCTTCCCTCTGATGTGG - Intergenic
1063078414 10:2740013-2740035 TTCTCATGTTGCCTTTGAGGCGG + Intergenic
1064401414 10:15024480-15024502 TCCACATCTGACCTTTGATTGGG - Intergenic
1066073206 10:31842999-31843021 TTCCAATATTACCTGGGATGAGG + Intronic
1066700910 10:38127119-38127141 TTCTCATCTTACATTTTTTGGGG - Intergenic
1067455370 10:46415339-46415361 TTCTCATCTTACCTGAGGTGGGG + Intergenic
1067631834 10:47969296-47969318 TTCTCATCTTACCTGAGGTGGGG - Intergenic
1068633848 10:59326705-59326727 TTCCCATGTGAGCTTTGCTGGGG - Intronic
1070468364 10:76749339-76749361 TTCCCATTTTAGCTGTGATAAGG + Intergenic
1072531772 10:96326466-96326488 TTCCCATGTTATCTCTAATGGGG - Intronic
1078869299 11:15328754-15328776 CTTCCATCTTACCTTTGGGGAGG + Intergenic
1080547304 11:33333355-33333377 TGCTCACCTTACCTTTGATTAGG + Intronic
1084287528 11:68141772-68141794 TTCCCAACTGAACCTTGATGAGG + Intergenic
1084746859 11:71176086-71176108 TTCCCATCTCACCATTCATGGGG + Intronic
1088044822 11:105436603-105436625 TTCCAATCTTCTCTTTTATGTGG + Intergenic
1088875589 11:113933629-113933651 TTCCCATCATAATTTTGAGGGGG - Intronic
1089269046 11:117288792-117288814 TTCCCATCTCACTTTTGGTCAGG + Exonic
1091954402 12:4626385-4626407 TTCCCATTTTACCTTCTCTGTGG + Intronic
1092643270 12:10540293-10540315 CTACCATCTGATCTTTGATGAGG + Intergenic
1093421955 12:18983927-18983949 GTCCCATCTGACCCTTGATTTGG + Intergenic
1096378408 12:51134079-51134101 ATCCCATCATTCCTTTAATGGGG - Intronic
1096409936 12:51369623-51369645 TTGCCATCTTCACTTGGATGTGG + Intronic
1097397616 12:59094779-59094801 TTCCCACCTTCCCTTTCATCTGG - Intergenic
1098989982 12:77054984-77055006 TTTCCGTCTTATGTTTGATGTGG - Intronic
1100961160 12:99964480-99964502 CTTCCATCTTTCCTCTGATGTGG - Intronic
1101891256 12:108717679-108717701 TTCCCACCTTCTCTTTGGTGTGG + Intronic
1108067240 13:46590696-46590718 GTCTCATCTTAAATTTGATGGGG + Intronic
1110691595 13:78436275-78436297 TTCCCATATTACCATTTAAGAGG - Intergenic
1112907856 13:104446315-104446337 TTCCCGTGTTACCTTCTATGGGG + Intergenic
1112912382 13:104503532-104503554 TTACCATCTTACATTTAGTGTGG - Intergenic
1113211055 13:107981816-107981838 TTCACATCTTACCTCTGATTTGG + Intergenic
1114879723 14:26769163-26769185 TTCTCATTTTTCCTTTGATGAGG + Intergenic
1118692421 14:68352820-68352842 TTCCCTTCTTATCTTTTCTGAGG + Intronic
1121394649 14:93609476-93609498 TTCCTACCATACCTTTAATGTGG - Intronic
1124868675 15:33519153-33519175 TGTCCAGCTGACCTTTGATGTGG + Intronic
1126724309 15:51615663-51615685 CTCCCATCATTCCTTTTATGTGG - Intronic
1130430038 15:83838382-83838404 TTCCCATTATATCTTTGAAGAGG + Intronic
1130798886 15:87240214-87240236 TTCCCAACTTCCCTGTGATTAGG + Intergenic
1137831980 16:51552699-51552721 TTCATATATGACCTTTGATGGGG + Intergenic
1138536982 16:57665645-57665667 TTCCCATCTTCCCTGTGATGAGG + Intergenic
1139307205 16:65997078-65997100 TTCACATCTGACCTTTGCAGAGG + Intergenic
1140918347 16:79513940-79513962 TTCCATTCTTTCCTTTGATGAGG - Intergenic
1141565854 16:84901425-84901447 TTTCCATTTTAATTTTGATGTGG + Intronic
1146769484 17:35555588-35555610 ATTCCATCTAACCTTAGATGGGG - Intronic
1147131054 17:38409266-38409288 TTCCCATCTCACCTTCAATCGGG - Intergenic
1149315691 17:55436309-55436331 TTCTCATTTTACCAGTGATGAGG + Intergenic
1154035387 18:10796417-10796439 TTCACATCTTATCTTAGATTTGG - Intronic
1155497523 18:26457609-26457631 ATCCAATGTTACCTTGGATGTGG + Intronic
1157847583 18:51017943-51017965 TTTCCATCTTTCCTTGGAGGAGG + Intronic
1158694304 18:59689756-59689778 TTCTCATGTGACCTGTGATGTGG - Intronic
1161862949 19:6812089-6812111 TTCCCATCTCTCCTTGCATGTGG - Intronic
1161915668 19:7226008-7226030 TTGTCATCTTGGCTTTGATGTGG - Intronic
1167265209 19:48479699-48479721 TTCCCATCGTTGCTTTCATGGGG + Intronic
932441704 2:71741432-71741454 TTCCCATCTTTCTTTTTCTGAGG + Intergenic
932863887 2:75321579-75321601 TTCCCATATTCGCTTTGATCAGG + Intergenic
935543159 2:104373389-104373411 TTGCTATCTCAGCTTTGATGTGG + Intergenic
937415670 2:121712622-121712644 GTGCCATGTTACCTCTGATGAGG + Intergenic
940172776 2:150846603-150846625 CTTCCTTCTTGCCTTTGATGGGG + Intergenic
940645332 2:156386521-156386543 CTCACATCTTACCATTTATGGGG + Intergenic
942283745 2:174392865-174392887 TTCTCTTCTTAACTTTGATGTGG - Intronic
943376106 2:187078651-187078673 TGCTCATCTTACTTCTGATGGGG + Intergenic
943430788 2:187798796-187798818 TTTCCATTATACCTTTGTTGGGG + Intergenic
946312627 2:218891482-218891504 TTCCCATCTTGACTTAGAGGCGG + Intronic
946814834 2:223566144-223566166 TTCCCATCTTCCCTGTCATCTGG + Intergenic
948777776 2:240298736-240298758 TTCCTGTCTTAGCTTTGCTGGGG + Intergenic
1170395267 20:15919321-15919343 TTCCTATCTGTCTTTTGATGTGG + Intronic
1172395905 20:34604952-34604974 TTCCCATCTTCCTTTTGCTTGGG - Intronic
1173045047 20:39501736-39501758 ATCCCATCTCACTTTTTATGTGG - Intergenic
1173062830 20:39678762-39678784 TTCCCTTCTTTCATTTGCTGAGG + Intergenic
1173313972 20:41927115-41927137 TTTCCATGATGCCTTTGATGAGG + Intergenic
1173540817 20:43849567-43849589 TTAGCATCTTAACTTTGAAGTGG + Intergenic
1174437354 20:50519590-50519612 TTCCCATCTTCAGTTTGAGGAGG + Intronic
1176085904 20:63295325-63295347 CTCCCGTCTTGCCTTTGTTGTGG - Intronic
1182643956 22:31792206-31792228 TTCCCATCTTTTCTGTTATGGGG + Intronic
949555321 3:5147565-5147587 TTCCCTTCTCTCCTTTGAGGGGG + Intronic
952195723 3:31073695-31073717 TTCCCAGCTTCCATTTGATTTGG + Intergenic
953216706 3:40925083-40925105 TCCCCATTTTACCACTGATGTGG + Intergenic
953514034 3:43572380-43572402 TGCCCCACTTACTTTTGATGAGG - Intronic
954841560 3:53516088-53516110 TTCTCATCTCACTTTTCATGTGG + Intronic
955081794 3:55664573-55664595 TTACCATCTCGCCTTTGATCAGG + Intronic
956430910 3:69185477-69185499 TTCCCATCTTTGCTGAGATGTGG + Intronic
959267359 3:104159181-104159203 TACCCAGATTACCTTTGAAGAGG - Intergenic
963562169 3:146879703-146879725 TACACATTTTACCGTTGATGAGG + Intergenic
963664861 3:148169916-148169938 TTCCTATCTGACCATTGATGTGG - Intergenic
963836382 3:150061974-150061996 TTCACATCATACCTCTGATTTGG - Intergenic
964547767 3:157853640-157853662 TTCCAAGCTTTCCATTGATGTGG - Intergenic
967711986 3:192719888-192719910 TTCCCAAATTACCTGTGTTGAGG + Intronic
968250133 3:197202167-197202189 TTCTCATCTTACATTTGTTATGG - Intronic
968856813 4:3131291-3131313 GTCCAATGTCACCTTTGATGCGG - Exonic
972038104 4:34552665-34552687 TTCACATTTTCCCTTTGATTTGG - Intergenic
973728748 4:53802898-53802920 TTCCCCTCTTCCAATTGATGGGG - Intronic
974722563 4:65760749-65760771 TTCCCATCTCAACGTTGATTGGG - Intergenic
974846378 4:67355376-67355398 TTCCCATCTAAGCATTGATCAGG - Intergenic
975961620 4:79915124-79915146 TTCCCTTCTTACTTATTATGAGG - Intronic
975974083 4:80074945-80074967 GTCCCATGTTCACTTTGATGTGG - Intronic
977759846 4:100720571-100720593 TTCCCATGTTATCTTTTATTAGG - Intronic
978442640 4:108750016-108750038 TTACCATATTACCTTTTAAGTGG + Intronic
982402598 4:154984678-154984700 TTCCCATGTTCCCTTTGCTTAGG - Intergenic
987703610 5:21433913-21433935 CATCCACCTTACCTTTGATGAGG - Intergenic
988114060 5:26860766-26860788 TTTCCATCTTCCCTTACATGTGG + Intergenic
988303957 5:29470551-29470573 CTCCCATGTTAACTCTGATGAGG + Intergenic
991336998 5:65559689-65559711 CTCCCATCTTATTTTTCATGAGG - Intronic
992080373 5:73230675-73230697 TCCCCATCAGACCTTTGAGGGGG + Intergenic
993869084 5:93228851-93228873 TTCCTTTCTGGCCTTTGATGTGG - Intergenic
995956734 5:117785613-117785635 TTCACATCTTTCCTTTGAGAAGG - Intergenic
996312186 5:122119187-122119209 TTCCCATCTTCCCTTCCATCTGG - Intergenic
996968491 5:129333788-129333810 TTCCCATCTTCCATTTAGTGAGG - Intergenic
997933967 5:138094813-138094835 TTCCCATCTGCTCTCTGATGTGG + Intergenic
1000564045 5:162825822-162825844 TTAACATCTAACCTTAGATGGGG - Intergenic
1002802945 6:543568-543590 TCACCAACTTACCTTTGTTGAGG - Intronic
1007071334 6:39040507-39040529 GTCCCATCTGACTTGTGATGTGG - Intergenic
1007690610 6:43698938-43698960 TTCCCATCTGACCTTTTAAAGGG + Intergenic
1011572952 6:88759797-88759819 TTCCCATCTCATCTCTCATGAGG + Intronic
1011919695 6:92557240-92557262 TTCATATCTTGCCTTAGATGTGG - Intergenic
1012414352 6:98996742-98996764 TTGCCCTCTTACCTTTGACATGG - Intergenic
1013811893 6:114054138-114054160 ATCCCATCTGATCTTAGATGTGG - Intergenic
1014541462 6:122680976-122680998 TTCCCTTCTTCCCTTTGCTGTGG + Intronic
1014813130 6:125907287-125907309 TTCCCATCTCACCTCCGCTGAGG + Intronic
1015079579 6:129207471-129207493 TTCACATTTTATATTTGATGTGG + Intronic
1016321511 6:142851516-142851538 TTCCCATTTAATCTTTTATGAGG + Intronic
1018096554 6:160392121-160392143 TCCCCATCCCACCTTTGATGGGG - Intronic
1023384694 7:39644348-39644370 TTCCCATCTTGACTGTGTTGAGG + Intronic
1024203367 7:47129063-47129085 TTTCCATTTTATCTGTGATGAGG + Intergenic
1027474095 7:78608205-78608227 TTCACATCTTTGCTTTGGTGGGG + Intronic
1027684503 7:81265182-81265204 GTTCCATCATACCTTTGGTGTGG + Intergenic
1035202364 7:157275941-157275963 TTTCATTCTTACCTTTGCTGAGG + Intergenic
1038955601 8:32464817-32464839 TTACCATTTTACCTGTGATAAGG - Intronic
1040525567 8:48221060-48221082 TTCCTATCTGACCTTGGATCAGG + Intergenic
1041175336 8:55191030-55191052 TTCCCATCTTTCCTAGGATTTGG + Intronic
1043423173 8:80121299-80121321 GTCACATCTTGCCTTTGCTGGGG - Intronic
1046167788 8:110461050-110461072 TTTCCATCTCACCTTACATGTGG - Intergenic
1046438483 8:114227354-114227376 TTATCATATTACCTTTGGTGAGG - Intergenic
1046673653 8:117085006-117085028 TTCAAATCCTTCCTTTGATGAGG + Intronic
1046868607 8:119178444-119178466 TTCATATCTTACCTTGGATCAGG - Intronic
1048027342 8:130598835-130598857 TTCCCATCTTACCTTCTCTGTGG + Intergenic
1049043492 8:140130382-140130404 TTCCCATCGTACCTATCAGGTGG - Intronic
1056377377 9:86028038-86028060 TTGCCATCTTGTCCTTGATGAGG - Intronic
1057556755 9:96094415-96094437 TTCCCACCTCACCTTTGAGAGGG + Intergenic
1187650932 X:21405131-21405153 TGCCCATTTTTCCTTTCATGTGG + Intronic
1188840392 X:35010221-35010243 TTCCTGACTTACCTATGATGAGG - Intergenic
1193777670 X:85663713-85663735 TTCTCATCTTATCTTTAATAAGG - Intergenic
1198510787 X:137349530-137349552 TTCCCATTTGACCTTTGCTCAGG + Intergenic
1199281042 X:145999551-145999573 TTACCACCTTACCTCTGATATGG - Intergenic