ID: 912542232

View in Genome Browser
Species Human (GRCh38)
Location 1:110425788-110425810
Sequence GAGCCTGGGCATGGCTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542232_912542234 -10 Left 912542232 1:110425788-110425810 CCTTTGGAGCCATGCCCAGGCTC No data
Right 912542234 1:110425801-110425823 GCCCAGGCTCAGCCCCATCCTGG No data
912542232_912542245 22 Left 912542232 1:110425788-110425810 CCTTTGGAGCCATGCCCAGGCTC No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912542232 Original CRISPR GAGCCTGGGCATGGCTCCAA AGG (reversed) Intergenic
No off target data available for this crispr