ID: 912542233

View in Genome Browser
Species Human (GRCh38)
Location 1:110425797-110425819
Sequence GATGGGGCTGAGCCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
912542233_912542245 13 Left 912542233 1:110425797-110425819 CCATGCCCAGGCTCAGCCCCATC No data
Right 912542245 1:110425833-110425855 GTGTCCGTTTTGCCACTGCCCGG No data
912542233_912542248 26 Left 912542233 1:110425797-110425819 CCATGCCCAGGCTCAGCCCCATC No data
Right 912542248 1:110425846-110425868 CACTGCCCGGCTACTTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
912542233 Original CRISPR GATGGGGCTGAGCCTGGGCA TGG (reversed) Intergenic
No off target data available for this crispr